View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk100-21 (Length: 184)

Name: R108-tnk100-21
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk100-21
R108-tnk100-21
[»] chr3 (4 HSPs)
chr3 (27-174)||(53662248-53662395)
chr3 (112-184)||(28525416-28525488)
chr3 (108-184)||(48440007-48440083)
chr3 (71-178)||(33131694-33131801)
[»] chr7 (1 HSPs)
chr7 (76-181)||(39681908-39682013)
[»] chr5 (2 HSPs)
chr5 (71-182)||(12574006-12574117)
chr5 (117-184)||(4597479-4597546)
[»] chr4 (3 HSPs)
chr4 (108-182)||(49450616-49450690)
chr4 (110-183)||(27794287-27794357)
chr4 (107-175)||(28805162-28805230)
[»] chr2 (1 HSPs)
chr2 (71-149)||(41130317-41130395)
[»] chr8 (1 HSPs)
chr8 (124-184)||(44651517-44651577)
[»] chr1 (2 HSPs)
chr1 (110-176)||(35425837-35425900)
chr1 (68-141)||(25631646-25631719)
[»] scaffold0274 (1 HSPs)
scaffold0274 (109-172)||(9082-9145)
[»] scaffold0271 (1 HSPs)
scaffold0271 (109-172)||(1216-1279)


Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 27 - 174
Target Start/End: Complemental strand, 53662395 - 53662248
Alignment:
27 tctatgcattttttcggaaacagtgaaaatacnnnnnnnnttgttttttattatttcctaatatgcatcatctataattggcatttcattttctatccat 126  Q
    ||||||||||||||||||||||||||||||||         |  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53662395 tctatgcattttttcggaaacagtgaaaatacaaaaaaaaattgtttttattatttcctaatatgcatcatctataattggcatttcattttctatccat 53662296  T
127 cacaatggttcacttaaagagtcgcacatcatcttataagcaagttaa 174  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||    
53662295 cacaatggttcacttaaagagtcacacatcatcttataagcaagttaa 53662248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 184
Target Start/End: Complemental strand, 28525488 - 28525416
Alignment:
112 tcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaaatgaacaca 184  Q
    |||| |||| ||||||||||||||||| || ||||||| |||||  ||| || || |||||||||||||||||    
28525488 tcatcttctctccatcacaatggttcatttcaagagtcacacattttctaattagtaagttaaaatgaacaca 28525416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 48440007 - 48440083
Alignment:
108 catttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaaatgaacaca 184  Q
    |||||||| | || |||||||||||| ||| ||| || |||| || ||| |||||| ||||||||||||||||||||    
48440007 catttcatctcctttccatcacaatgattcgcttcaaaagtctcatatcttcttattagcaagttaaaatgaacaca 48440083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 71 - 178
Target Start/End: Complemental strand, 33131801 - 33131694
Alignment:
71 tttttattatttcctaatatgcatcatctataattggcatttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaag 170  Q
    |||||||||||||| || |||||||||||  |  | | ||||||| |||| | ||| |||||||||||||| | ||||| |||||| |  ||| |||||     
33131801 tttttattatttccaaaaatgcatcatctcgatctagtatttcatcttctcttcattacaatggttcacttcaggagtctcacatctttgtattagcaac 33131702  T
171 ttaaaatg 178  Q
    ||||||||    
33131701 ttaaaatg 33131694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 76 - 181
Target Start/End: Original strand, 39681908 - 39682013
Alignment:
76 attatttcctaatatgcatcatctataattggcatttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaa 175  Q
    ||||||| | || ||||||||||||||| | ||||||||| |||| ||||||||||||||||| || ||||||| | |||| |||||| |||||||||||    
39681908 attattttcaaaaatgcatcatctataactagcatttcatcttctctccatcacaatggttcattttaagagtctcgcatcttcttattagcaagttaaa 39682007  T
176 atgaac 181  Q
    ||||||    
39682008 atgaac 39682013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 182
Target Start/End: Original strand, 12574006 - 12574117
Alignment:
71 tttttattatttcctaatatgcatcatctataattggcatttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaag 170  Q
    |||| |||||||||  | |||||||||| |||  | ||||||||| |||| |||||||||||||||||||| ||||||| ||||||   |||| ||||||    
12574006 ttttcattatttccataaatgcatcatccatagctagcatttcatcttctctccatcacaatggttcacttcaagagtctcacatctaattattagcaag 12574105  T
171 ttaaaatgaaca 182  Q
    ||||||||||||    
12574106 ttaaaatgaaca 12574117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 117 - 184
Target Start/End: Complemental strand, 4597546 - 4597479
Alignment:
117 ttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaaatgaacaca 184  Q
    |||| |||||||||||||||||||| ||||||| ||  || |||||| | ||||| ||||| ||||||    
4597546 ttctctccatcacaatggttcacttcaagagtctcaattcttcttattaacaagtaaaaattaacaca 4597479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000006; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 108 - 182
Target Start/End: Original strand, 49450616 - 49450690
Alignment:
108 catttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaaatgaaca 182  Q
    |||||||| | || ||||| ||||| |||||||| ||||||| |||||| |||| | ||||||||||||||||||    
49450616 catttcatctactctccattacaatagttcacttcaagagtctcacatcttcttgttagcaagttaaaatgaaca 49450690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 183
Target Start/End: Original strand, 27794287 - 27794357
Alignment:
110 tttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaaatgaacac 183  Q
    |||||| |||| ||||||||| |||||||||| ||||| | ||||||   |||| |||||||||||||||||||    
27794287 tttcatcttctctccatcacattggttcacttcaagagcctcacatc---ttatgagcaagttaaaatgaacac 27794357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 175
Target Start/End: Complemental strand, 28805230 - 28805162
Alignment:
107 gcatttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaa 175  Q
    ||||||||| || | |||||||||||||||| ||  ||||||| |||||  |||||| |||||||||||    
28805230 gcatttcatcttatctccatcacaatggttcgctctaagagtctcacatattcttattagcaagttaaa 28805162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 71 - 149
Target Start/End: Original strand, 41130317 - 41130395
Alignment:
71 tttttattatttcctaatatgcatcatctataattggcatttcattttctatccatcacaatggttcacttaaagagtc 149  Q
    |||| ||||||||  || ||||||||||| ||||| ||||||||| ||||  |||||||||||||||| || |||||||    
41130317 ttttcattatttctaaaaatgcatcatctctaattagcatttcatcttctccccatcacaatggttcatttcaagagtc 41130395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 184
Target Start/End: Original strand, 44651517 - 44651577
Alignment:
124 catcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaaatgaacaca 184  Q
    |||||||||||||||||| ||||||| | |||| |||||| || |||||||||||| ||||    
44651517 catcacaatggttcactttaagagtctcgcatcttcttattagaaagttaaaatgagcaca 44651577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 35425837 - 35425900
Alignment:
110 tttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagttaaaa 176  Q
    ||||||||||| |||||||||||||||||||| ||||||  | || |||||||| ||||||||||||    
35425837 tttcattttctctccatcacaatggttcactt-aagagt--ctcaacatcttattagcaagttaaaa 35425900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 68 - 141
Target Start/End: Original strand, 25631646 - 25631719
Alignment:
68 tgttttttattatttcctaatatgcatcatctataattggcatttcattttctatccatcacaatggttcactt 141  Q
    ||||||| ||||||||   | ||||||||||| ||| | ||||||||| |||| |||||||||||| |||||||    
25631646 tgtttttcattatttctggaaatgcatcatctttaactagcatttcatcttctctccatcacaatgattcactt 25631719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0274 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: scaffold0274
Description:

Target: scaffold0274; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 109 - 172
Target Start/End: Complemental strand, 9145 - 9082
Alignment:
109 atttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagtt 172  Q
    ||||||| |||| ||||||| |||| ||||||||||||||  || ||| |||||| ||||||||    
9145 atttcatcttctctccatcaaaatgattcacttaaagagtgacaaatcttcttattagcaagtt 9082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0271 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: scaffold0271
Description:

Target: scaffold0271; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 109 - 172
Target Start/End: Original strand, 1216 - 1279
Alignment:
109 atttcattttctatccatcacaatggttcacttaaagagtcgcacatcatcttataagcaagtt 172  Q
    ||||||| |||| ||||||| |||| ||||||||||||||  || ||| |||||| ||||||||    
1216 atttcatcttctctccatcaaaatgattcacttaaagagtgacaaatcttcttattagcaagtt 1279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360110 times since January 2019
Visitors: 481