View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk100-24 (Length: 1398)

Name: R108-tnk100-24
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk100-24
R108-tnk100-24
[»] chr1 (6 HSPs)
chr1 (102-794)||(42125554-42126257)
chr1 (1024-1398)||(42126544-42126933)
chr1 (791-1041)||(42126285-42126532)
chr1 (12-82)||(42125489-42125559)
chr1 (900-992)||(1014808-1014900)
chr1 (1027-1107)||(22875746-22875826)
[»] chr2 (4 HSPs)
chr2 (1089-1199)||(34190309-34190419)
chr2 (484-651)||(31069701-31069869)
chr2 (517-652)||(35509071-35509208)
chr2 (468-549)||(12544850-12544930)
[»] chr7 (1 HSPs)
chr7 (1096-1176)||(8615416-8615496)
[»] chr4 (2 HSPs)
chr4 (900-992)||(8904089-8904181)
chr4 (912-992)||(45066078-45066158)
[»] chr8 (2 HSPs)
chr8 (900-992)||(45483998-45484090)
chr8 (495-549)||(37684890-37684943)
[»] chr6 (2 HSPs)
chr6 (900-992)||(18819130-18819222)
chr6 (900-992)||(24903898-24903990)
[»] chr3 (3 HSPs)
chr3 (900-992)||(26905368-26905460)
chr3 (900-992)||(36615580-36615672)
chr3 (940-992)||(28210994-28211046)
[»] chr5 (1 HSPs)
chr5 (1033-1081)||(26460003-26460051)


Alignment Details
Target: chr1 (Bit Score: 527; Significance: 0; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 527; E-Value: 0
Query Start/End: Original strand, 102 - 794
Target Start/End: Original strand, 42125554 - 42126257
Alignment:
102 gtagtgacatataaataatttctctctcgattatacttcataaagttgttaccaattaatcgatttgttgatctatcaatatacatgatttcaacgaaat 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42125554 gtagtgacatataaataatttctctctcgattatacttcataaagttgttaccaattaatcgatttgttgatctatcaatatacatgatttcaacgaaat 42125653  T
202 aattgatgataataataaacgagtaataaatatccaatccagtttctatccaagaaaatattcaaaggtgannnnnnnn--aacgatgataaaaattaat 299  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||    
42125654 aattgatgataataataaacgagtaataaatatccaatccagtttctatccaagaaaatattcaaaggtgattttttttttaacgatgataaaaattaat 42125753  T
300 ttgaaatcaaattaaaatatttcaagaacctgaatttgggataattccagaaattactatgtttttt-agttcgagagacgattatgagtatgaaaggtg 398  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||    
42125754 ttgaaatcaaattaaaatatttcaagaacctgaatttgggataattccagaaattactatgtttttttaggtcgagagacgattatgagtatgaaaggtg 42125853  T
399 ttaacaccttatgatatctgtggttcttgtgaaga-------tcacgtagcttgcatatttttgaggcaagagacatatgtgttccagccggtggatatg 491  Q
    |||||||||||| ||||||||||||||||||||||       ||| |||||| |||||||||||||||||||||||||||||||||| | ||||||||||    
42125854 ttaacaccttataatatctgtggttcttgtgaagaatgaagatcatgtagctcgcatatttttgaggcaagagacatatgtgttccaactggtggatatg 42125953  T
492 ttgaaattcacctcttgaaagtgattttttaggaaaatattttgatcacacgtgttcccttatgagtgagattattaacttcttatgcgttgacactgat 591  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||    
42125954 ttgaaattcacttcttgaaagtgattttttaggaaaatattttgatcacacatgttcccttatgagtgagattattaacttcttatgtgttgacactgat 42126053  T
592 agttcatgcggtggatttgtttaggggttggttgactgtgggattttgttcctagtcttccttgngttcacctanggt-nagtaatcctgatagaaaata 690  Q
    | |||||| ||||||||||||||| |||||||||| |||||| ||||||||||||||||||||| ||||| ||| |||  ||||||||| |||||| ||     
42126054 aattcatgtggtggatttgtttagaggttggttgaatgtggggttttgttcctagtcttccttgtgttcatctaaggtcaagtaatcctaatagaagatt 42126153  T
691 agatgg-ttttagggctggacaaaaataaccaataaccgacccaacccgtctgaactggatggtccaaaacacatcaggtcagttctctcggataactga 789  Q
    |||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
42126154 agatggtttttagggctggacaaaaataa-caataaccgacccaacccgtttgaactggatggtccaaaacacatcaggtcagttctctcggataactga 42126252  T
790 gttgg 794  Q
    |||||    
42126253 gttgg 42126257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 249; E-Value: 1e-137
Query Start/End: Original strand, 1024 - 1398
Target Start/End: Original strand, 42126544 - 42126933
Alignment:
1024 gagtattcaatggttcttgattagccgaagaactagctttgtttctagaaatcacgggnnnnnnnttcttcgtcctataaaacatagcaatgactttgtg 1123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||| |||||||||||||    
42126544 gagtattcaatggttcttgattagccgaagaactagctttgtttctagaaatcacgggaaaaaaattcttcgtcctataaaacataacaatgactttgtg 42126643  T
1124 agcataacaaacaaacaattcaatggccaattaagagctattccttccatcaaaattgtgagcataacaaacaaaacggtgatgcattcg---------- 1213  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||              
42126644 agtataacaaacaaacaattcaatggccaattaagagctattccttccatcaaaattgtgagcataacaaacaaaacggtgatgcattcgattaactgaa 42126743  T
1214 -----atttactgaagtttaattttctcagcagccataacaaacaacaaatgctcacaagccatgaaaagagtcaacacnnnnnnnttatgagcagccat 1308  Q
         |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||       ||||||||||||||    
42126744 gtttaatttactggagtttaattttctcagcagccataacaaacaacaaatgctcacaagccatgaaaagagtcgacacaaaaaaattatgagcagccat 42126843  T
1309 aactaacaaattctctttaatcctggagtataatttacttagcagcnnnnnnnttatgtgtatttatataggatggccatgagtacaatt 1398  Q
    ||| ||||||||||||||||||||||||| ||||||||||||||||       ||||||||||||||||| |||||||||||||||||||    
42126844 aacaaacaaattctctttaatcctggagtttaatttacttagcagcaaaaaaattatgtgtatttatataagatggccatgagtacaatt 42126933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 192; E-Value: 1e-103
Query Start/End: Original strand, 791 - 1041
Target Start/End: Original strand, 42126285 - 42126532
Alignment:
791 ttggtcggttataagttggaattattggcccagtgcatgggtgaatctagacttctggttcatacgaggccaaaatttcaaagaaacaataatgnacnna 890  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |        
42126285 ttggtcggttataagttggaattattggcccagtgcatggatgaatctagacttctggttcatacgaggtcaaaatttcaaagaaacaataatgca---- 42126380  T
891 aactatattaggatgataacatgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttg 990  Q
    |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||  || ||| ||||||||    
42126381 aactatgttaggatgataacatgaaattggaggcctaagtccagggcctgtttccaacaatttgtaatcaacaactttaataccatcattggtcgagttg 42126480  T
991 ggtataacttcatgtcgtggttcacttggatg-tgagtattcaatggttctt 1041  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||    
42126481 ggtataacttcatgtcgtggttcacttggatgttgagtattcaatggttctt 42126532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 52; E-Value: 4e-20
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 42125489 - 42125559
Alignment:
12 gatcaaagtaagcaacacataatcaaaatgctcacagaagtaattttagctacacggnacatgaagtagtg 82  Q
    ||||||||| |||| |||||||||||||||||||||||||||||||||| ||||||  |||||||||||||    
42125489 gatcaaagtgagcatcacataatcaaaatgctcacagaagtaattttagttacacgagacatgaagtagtg 42125559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 45; E-Value: 6e-16
Query Start/End: Original strand, 900 - 992
Target Start/End: Complemental strand, 1014900 - 1014808
Alignment:
900 aggatgataacatgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    ||||||||| | ||||||||||||||||| ||  ||  |||||||||||||||| |||||||||||||||| || ||| ||| ||||||||||    
1014900 aggatgatagcttgaaattggaggcctaattcctggatctgtttccaacaatttataatcaacaactttaacaccctcattggtcgagttggg 1014808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 1027 - 1107
Target Start/End: Complemental strand, 22875826 - 22875746
Alignment:
1027 tattcaatggttcttgattagccgaagaactagctttgtttctagaaatcacgggnnnnnnnttcttcgtcctataaaaca 1107  Q
    ||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||       |||||| ||||||||||||    
22875826 tattcgatggttcttgattagccgaagaactagctttgtctctagaaagcacgggaaaaaatttcttcatcctataaaaca 22875746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 83; Significance: 1e-38; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 1e-38
Query Start/End: Original strand, 1089 - 1199
Target Start/End: Original strand, 34190309 - 34190419
Alignment:
1089 ttcttcgtcctataaaacatagcaatgactttgtgagcataacaaacaaacaattcaatggccaattaagagctattccttccatcaaaattgtgagcat 1188  Q
    |||||| |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |    
34190309 ttcttcatcctataaaatataacaatgacattgtgagcataacaaacaaacaattcaatggccaattaagagttactccttccatcaaaattgtgagcgt 34190408  T
1189 aacaaacaaaa 1199  Q
    |||||||||||    
34190409 aacaaacaaaa 34190419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000008
Query Start/End: Original strand, 484 - 651
Target Start/End: Original strand, 31069701 - 31069869
Alignment:
484 tggatatgttgaaattcacctcttgaaagtgattttttaggaaaatattttgatcacacgtgttccct-tatgagtgagattattaacttcttatgcgtt 582  Q
    |||||||| | ||||||||||||||||||| | |||||||||||| ||| || | |||| |||||| | |||||||||||| || ||||  |||||||||    
31069701 tggatatggttaaattcacctcttgaaagt-agtttttaggaaaacattctggttacacatgttccttctatgagtgagatcatgaactcattatgcgtt 31069799  T
583 gacactgatagt-tcatgcggtggatttgtttaggggttggttgactgtgggattttgttcctagtcttc 651  Q
    | ||| ||||||  | ||  | | |||||| ||  ||||| ||||| | |||||||||||||||||||||    
31069800 gccaccgatagtgacttgttgcgaatttgtctataggttgattgacggagggattttgttcctagtcttc 31069869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 517 - 652
Target Start/End: Original strand, 35509071 - 35509208
Alignment:
517 tttttaggaaaatattttgatcacacgtgttccct-tatgagtgagattattaacttcttatgcgttgacactgatagt-tcatgcggtggatttgttta 614  Q
    |||||||||||| ||| || |||||| |||||| | |||||||| ||| || ||||  ||||| | ||| ||||||||| || || || |||||||||||    
35509071 tttttaggaaaacattgtggtcacacatgttccttctatgagtgggatcatgaactcattatgtgatgatactgatagtgtcttgtggcggatttgttta 35509170  T
615 ggggttggttgactgtgggattttgttcctagtcttcc 652  Q
     ||||||||||||   |||||| ||||| |||||||||    
35509171 agggttggttgaccaagggattatgttcatagtcttcc 35509208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000005
Query Start/End: Original strand, 468 - 549
Target Start/End: Complemental strand, 12544930 - 12544850
Alignment:
468 tatgtgttccagccggtggatatgttgaaattcacctcttgaaagtgattttttaggaaaatattttgatcacacgtgttcc 549  Q
    |||||| |||||  |||||||||| | ||||||| |||||| ||||| ||||| ||||||||||| || || ||||||||||    
12544930 tatgtgctccagttggtggatatggttaaattcatctcttggaagtggttttt-aggaaaatattatggtcgcacgtgttcc 12544850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 69; Significance: 3e-30; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 3e-30
Query Start/End: Original strand, 1096 - 1176
Target Start/End: Original strand, 8615416 - 8615496
Alignment:
1096 tcctataaaacatagcaatgactttgtgagcataacaaacaaacaattcaatggccaattaagagctattccttccatcaa 1176  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||    
8615416 tcctataaaacataacaatgactttgtgagcataacaaacaaacaattcaatggccaattaagagttactccttccatcaa 8615496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 49; Significance: 2e-18; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 900 - 992
Target Start/End: Complemental strand, 8904181 - 8904089
Alignment:
900 aggatgataacatgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    ||||||||| ||||||||||||||||||| ||  ||  | |||||||||||||| ||||||||||||||||||| ||| ||| ||||||||||    
8904181 aggatgatagcatgaaattggaggcctaattcctggatccgtttccaacaatttataatcaacaactttaataccctcattggtcgagttggg 8904089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000008
Query Start/End: Original strand, 912 - 992
Target Start/End: Original strand, 45066078 - 45066158
Alignment:
912 tgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    ||||||||||||||||| ||  ||  | |||||||||||||  ||||||||||||||||||| ||  ||| ||||||||||    
45066078 tgaaattggaggcctaattcctggatccgtttccaacaattcataatcaacaactttaatacccttattggtcgagttggg 45066158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 6e-16; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 6e-16
Query Start/End: Original strand, 900 - 992
Target Start/End: Complemental strand, 45484090 - 45483998
Alignment:
900 aggatgataacatgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    ||||||||| | ||||||||||||||||| ||  ||  |||||||||||||||| |||||||||||||||| || ||| ||| ||||||||||    
45484090 aggatgatagcttgaaattggaggcctaattcctggatctgtttccaacaatttataatcaacaactttaacaccctcattggtcgagttggg 45483998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 495 - 549
Target Start/End: Complemental strand, 37684943 - 37684890
Alignment:
495 aaattcacctcttgaaagtgattttttaggaaaatattttgatcacacgtgttcc 549  Q
    |||||||||||||| ||||||||||| |||||||||||||| |||||| ||||||    
37684943 aaattcacctcttggaagtgattttt-aggaaaatattttggtcacacttgttcc 37684890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 6e-16; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 6e-16
Query Start/End: Original strand, 900 - 992
Target Start/End: Original strand, 18819130 - 18819222
Alignment:
900 aggatgataacatgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    ||||||||| | ||||||||||||||||| ||  ||  |||||||||||||||| |||||||||||||||| || ||| ||| ||||||||||    
18819130 aggatgatagcttgaaattggaggcctaattcctggatctgtttccaacaatttataatcaacaactttaacaccctcattggtcgagttggg 18819222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 900 - 992
Target Start/End: Original strand, 24903898 - 24903990
Alignment:
900 aggatgataacatgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    ||||||||| | ||||||||||||||||| ||  ||  | |||||||||||||| |||||||||||||||| || ||| ||| ||||||||||    
24903898 aggatgatagcttgaaattggaggcctaattcctggatccgtttccaacaatttataatcaacaactttaacaccctcattggtcgagttggg 24903990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 6e-16; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 6e-16
Query Start/End: Original strand, 900 - 992
Target Start/End: Original strand, 26905368 - 26905460
Alignment:
900 aggatgataacatgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    ||||||||| | ||||||||||||||||| ||  ||  |||||||||||||||| |||||||||||||||| || ||| ||| ||||||||||    
26905368 aggatgatagcttgaaattggaggcctaattcctggatctgtttccaacaatttataatcaacaactttaacaccctcattggtcgagttggg 26905460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 45; E-Value: 6e-16
Query Start/End: Original strand, 900 - 992
Target Start/End: Complemental strand, 36615672 - 36615580
Alignment:
900 aggatgataacatgaaattggaggcctaagtctagggcctgtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    ||||||||| | ||||||||||||||||| ||  ||  |||||||||||||||| |||||||||||||||| || ||| ||| ||||||||||    
36615672 aggatgatagcttgaaattggaggcctaattcctggatctgtttccaacaatttataatcaacaactttaacaccctcattggtcgagttggg 36615580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000008
Query Start/End: Original strand, 940 - 992
Target Start/End: Original strand, 28210994 - 28211046
Alignment:
940 gtttccaacaatttgtaatcaacaactttaatactctcgttgatcgagttggg 992  Q
    |||||||||||||| |||||||||||||||| || ||| ||| ||||||||||    
28210994 gtttccaacaatttataatcaacaactttaacaccctcattggtcgagttggg 28211046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000008
Query Start/End: Original strand, 1033 - 1081
Target Start/End: Original strand, 26460003 - 26460051
Alignment:
1033 atggttcttgattagccgaagaactagctttgtttctagaaatcacggg 1081  Q
    |||||||||||||| |||||||||||||||||| ||| |||| ||||||    
26460003 atggttcttgattaaccgaagaactagctttgtctcttgaaagcacggg 26460051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310763 times since January 2019
Visitors: 444