View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk100-25 (Length: 795)

Name: R108-tnk100-25
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk100-25
R108-tnk100-25
[»] chr4 (8 HSPs)
chr4 (1-475)||(48973932-48974406)
chr4 (472-795)||(48973613-48973936)
chr4 (131-452)||(48958088-48958421)
chr4 (154-475)||(48951210-48951531)
chr4 (131-278)||(48912433-48912580)
chr4 (145-451)||(48961249-48961569)
chr4 (343-470)||(48965494-48965621)
chr4 (131-268)||(48965273-48965410)
[»] scaffold0536 (4 HSPs)
scaffold0536 (154-452)||(6413-6723)
scaffold0536 (155-433)||(1386-1664)
scaffold0536 (145-268)||(10591-10714)
scaffold0536 (346-451)||(10396-10501)
[»] chr2 (4 HSPs)
chr2 (163-452)||(13448339-13448637)
chr2 (343-470)||(13440365-13440492)
chr2 (172-470)||(13454819-13455126)
chr2 (172-233)||(13440185-13440246)
[»] chr5 (2 HSPs)
chr5 (343-470)||(28385499-28385626)
chr5 (343-470)||(12540850-12540977)
[»] chr8 (2 HSPs)
chr8 (162-329)||(12641518-12641685)
chr8 (343-467)||(12641368-12641492)
[»] chr7 (1 HSPs)
chr7 (343-470)||(3417414-3417541)
[»] chr6 (4 HSPs)
chr6 (343-453)||(12483365-12483475)
chr6 (139-329)||(12483504-12483694)
chr6 (131-268)||(12590270-12590407)
chr6 (343-452)||(12590071-12590180)


Alignment Details
Target: chr4 (Bit Score: 463; Significance: 0; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 463; E-Value: 0
Query Start/End: Original strand, 1 - 475
Target Start/End: Original strand, 48973932 - 48974406
Alignment:
1 tcttgtgcccgctttctgatttcaacagcttcaattccaccatccatcaacctcctcagagccttctctataatgtctctgcccactatcttcttcttct 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48973932 tcttgtgctcgctttctgatttcaacagcttcaattccaccatccatcaacctcctcagagccttctctataatgtctctgcccactatcttcttcttct 48974031  T
101 tcatgaatccaatgaagctccactcctccacaccaacctccacaccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48974032 tcatgaatccaatgaagctccactcctccacaccaacctccacaccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcac 48974131  T
201 tggccacgtgatcattggaacccctgcactaacggcttccacggtggagttccacccgcaatgtgtcaagaatgcaccaatagcagggtggcctaaaatc 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
48974132 tggccacgtgatcattggaacccctgcactaacggcttccacggtggagttccacccgcaatgtgtcaagaatgcaccgatagcagggtggcctaaaatc 48974231  T
301 accacttgtggggcccacccccttatgatcatcccgatattcctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctt 400  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48974232 accacttgtggggcccacccccttatgatcatcccaatattcctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctt 48974331  T
401 tccctttcttctcggggacaacccatatgaattggtgacccgatgcttctattgcgcttgcaatctcatacaatt 475  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48974332 tccctttcttctcggggacaacccatatgaattggtgacccgatgcttctattgcgcttgcaatctcatacaatt 48974406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 472 - 795
Target Start/End: Original strand, 48973613 - 48973936
Alignment:
472 aattcaccagtataatatgactttagaaaaattgagaaagaaaagagattatttaaatataagtttttcttgataaatgtaaatccaaacaggcatttgc 571  Q
    ||||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
48973613 aattcaccagtataatatgactttagaaaaattgaaaaagaaaatagattatctaaatataagtttttcttgataaatgtaaatccaaacaggcatttgc 48973712  T
572 acacttagggcaatacaacaatgnnnnnnngttggtcttagcctcgagctggtctttattttgtgattcttagcaacaaatataaataaatgatgttgaa 671  Q
    |||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48973713 acacttagggcaatacaacaatgtttttttgttggtcttagcctcgagctggtctttattttgtgattcttagcaacaaatataaataaatgatgttgaa 48973812  T
672 atccttaaggatctaatgacttgtgtcccctttgtcgtttaagatcatcaatcaatgccattaaatttttgtgggacgaaccaccttcttggacagctcg 771  Q
    ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48973813 atccttaagaatctaatgacttatgtcccctttgtcgtttaagatcatcaatcaatgccattaaatttttgtgggacgaaccaccttcttggacagctcg 48973912  T
772 tttggcctttattgcatattcttg 795  Q
    ||||||||||||||||||||||||    
48973913 tttggcctttattgcatattcttg 48973936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 131 - 452
Target Start/End: Original strand, 48958088 - 48958421
Alignment:
131 caccaacctccacaccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcact 230  Q
    ||||||||||||| ||||| || ||||| | ||||||||||||||| ||||||||||||||  ||||||| ||||||||||||||||||||||| || ||    
48958088 caccaacctccaccccaattcctcgcacattagttatcaacttctcattgtagaattgttctccatgcaccggccacgtgatcattggaacccccgcgct 48958187  T
231 aacggcttccacggtggagttccacccgcaatgtgtcaagaatgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgatc 330  Q
    ||| || ||||| |||||||||||||||||||||||||  |||||||| |  |||  |||||  | |||||  |||||||||||||||||||| ||||||    
48958188 aacagcctccacagtggagttccacccgcaatgtgtcataaatgcacccacggcaatgtggctcagaatcaaaacttgtggggcccaccccctaatgatc 48958287  T
331 a------------tcccgatattcctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcgggga 418  Q
    |            | || || || |||||||| ||||| || |||| ||||||| | ||||| || |  ||||| || ||||||||||||||||| || |    
48958288 aaacctttcttctttccaatgtttctctcttcgaatcctttcggcaaccactttcctttctcctcttcactctcgtcttctttccctttcttctcaggaa 48958387  T
419 caacccatatgaattggtgacccgatgcttctat 452  Q
    |||||||||  |||| |||||| |||||||||||    
48958388 caacccatacaaattcgtgacctgatgcttctat 48958421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 154 - 475
Target Start/End: Original strand, 48951210 - 48951531
Alignment:
154 cgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggcttccacggtggagttcc 253  Q
    ||||| |||||||| | |||||| |||||||| || ||   |||||| |||||||||||||| ||||||||| ||||||  || |||      |||||||    
48951210 cgcacatgagttatgagcttctcattgtagaactgatcactatgcaccggccacgtgatcatcggaacccctacactaatagcctccgtcacagagttcc 48951309  T
254 acccgcaatgtgtcaagaatgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgatcatcccgatattcctctcttcaaa 353  Q
    |||| ||||||||||| || || ||||  ||||| || ||||| || ||||  || || ||||| |||||||  ||||||||  ||||||||||||||||    
48951310 acccacaatgtgtcaaaaacgcgccaacggcaggatgccctaatataaccatctgcggcgcccatccccttacaatcatccccttattcctctcttcaaa 48951409  T
354 tccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccgatgcttctatt 453  Q
      || | || | ||| ||||| ||||| ||||  ||||| | ||| ||||| ||||| || |||||||||||||||||||  | ||| ||| |||||||     
48951410 ctccctgggtaaccatttttccttctcctcatcactctcgttctccttccccttcttttctgggacaacccatatgaattcataacctgattcttctatc 48951509  T
454 gcgcttgcaatctcatacaatt 475  Q
    ||||||||||||||||||||||    
48951510 gcgcttgcaatctcatacaatt 48951531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 131 - 278
Target Start/End: Complemental strand, 48912580 - 48912433
Alignment:
131 caccaacctccacaccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcact 230  Q
    |||| |||||||| ||||| ||  ||||||| |||||||||||||| ||||| || |||||  ||||||  |||||||||||||||||||||||||||||    
48912580 caccgacctccaccccaatcccatgcacctgtgttatcaacttctcattgtaaaactgttctccatgcatcggccacgtgatcattggaacccctgcact 48912481  T
231 aacggcttccacggtggagttccacccgcaatgtgtcaagaatgcacc 278  Q
    ||| || || || ||||| |||||||| ||||||||||  ||||||||    
48912480 aactgcctcaacagtggaattccacccacaatgtgtcataaatgcacc 48912433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 145 - 451
Target Start/End: Original strand, 48961249 - 48961569
Alignment:
145 ccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggcttccacgg 244  Q
    |||||||||||||| | ||||||||||||||||||||||||||||||  |||| || ||||| || |||||||| | |||||||||| | || || | ||    
48961249 ccaataccccgcacatcagttatcaacttctcgttgtagaattgttctccatgtacgggccatgttatcattgggatccctgcactaccagcctcaatgg 48961348  T
245 tg--gagttccacccgcaatgtgtcaagaatgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgatca----------- 331  Q
    ||  ||||||||||||||||| ||||  ||  |||| |  || | |||||| |  ||||  |||||||||||||||||| | |||||||               
48961349 tggagagttccacccgcaatgcgtcataaacacacccaccgctgtgtggcccaggatcataacttgtggggcccaccccttaatgatcaaacccttcttc 48961448  T
332 -tcccgatattcctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatga 430  Q
     |  | || || |||||||||||||| || |||| |||||| || ||||| || | |||||||||| |||||||||| ||||| || ||||||||||  |    
48961449 ttttcaatgtttctctcttcaaatcctttcggcaaccacttgtctttctcctcttcgctctcatccactttcccttttttctcaggaacaacccatacaa 48961548  T
431 attggtgacccgatgcttcta 451  Q
    ||| |||||||||||||||||    
48961549 attcgtgacccgatgcttcta 48961569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 343 - 470
Target Start/End: Original strand, 48965494 - 48965621
Alignment:
343 ctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccg 442  Q
    |||||||| ||||||||||| | ||||||||  ||||| || |  ||||||||||||||||| || ||   ||| | ||||||||| || |  |||||||    
48965494 ctctcttcgaatccctttggtaaccacttttgcttctcctcttcactctcatcctctttcccgttattaaggggaataacccatataaaatcatgacccg 48965593  T
443 atgcttctattgcgcttgcaatctcata 470  Q
    ||||||||||||| |  |||||||||||    
48965594 atgcttctattgcacacgcaatctcata 48965621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 268
Target Start/End: Original strand, 48965273 - 48965410
Alignment:
131 caccaacctccacaccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcact 230  Q
    ||||||| ||||| ||||| || ||||| |  |||||||  || |||||||||||||||||  ||||    ||||| || ||||| |||||||| ||||     
48965273 caccaacttccactccaatccctcgcacttctgttatcagtttttcgttgtagaattgttctccatgtgaaggccatgtaatcatcggaacccccgcacc 48965372  T
231 aacggcttccacggtggagttccacccgcaatgtgtca 268  Q
    ||| || ||||| ||||||||||| || ||||| ||||    
48965373 aacagcctccactgtggagttccaaccacaatgagtca 48965410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536 (Bit Score: 86; Significance: 1e-40; HSPs: 4)
Name: scaffold0536
Description:

Target: scaffold0536; HSP #1
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 154 - 452
Target Start/End: Complemental strand, 6723 - 6413
Alignment:
154 cgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggcttccacggtggagttcc 253  Q
    |||||||| ||||||||||| || ||||| ||||||||  ||||||| |||||||||||||| ||||||||||||||||| || || || ||||| ||||    
6723 cgcacctgtgttatcaacttttcattgtaaaattgttctccatgcaccggccacgtgatcatcggaacccctgcactaacagcctcaacagtggaattcc 6624  T
254 acccgcaatgtgtcaagaatgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgatca------------tcccgatatt 341  Q
    |||| ||||| ||||  || ||||| | |||   |||||  |||||||  |||||||| ||||| ||||| || ||||            | ||||||||    
6623 acccacaatgcgtcataaacgcacccagagctttgtggctcaaaatcataacttgtggagcccaacccctaataatcaaacccttcttctttccgatatt 6524  T
342 cctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgaccc 441  Q
     |||||||| ||||||||||||| ||| ||| | ||||| || |  |||||||| ||||||||||||||||| || |||||||||||||||| |||||||    
6523 tctctcttcgaatccctttggcaaccattttcctttctcctcttcactctcatcttctttccctttcttctcaggaacaacccatatgaatttgtgaccc 6424  T
442 gatgcttctat 452  Q
    |||||||||||    
6423 gatgcttctat 6413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536; HSP #2
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 155 - 433
Target Start/End: Complemental strand, 1664 - 1386
Alignment:
155 gcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggcttccacggtggagttcca 254  Q
    ||||||||||||||||| | ||||| |||||||| ||   ||| |||||||| |||||||||||||  ||||||||||| || ||     | ||||||||    
1664 gcacctgagttatcaacgtttcgttatagaattgatcactatgtactggccatgtgatcattggaattcctgcactaacagcctcggttatagagttcca 1565  T
255 cccgcaatgtgtcaagaatgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgatcatcccgatattcctctcttcaaat 354  Q
    ||| ||||||||||| |||||||| ||||| | |||||| || || ||||||||||||  ||| |||||||  ||||||||  || ||||||||||||||    
1564 cccacaatgtgtcaaaaatgcacctatagcggagtggcccaagataaccacttgtgggctccagccccttacaatcatccccttagtcctctcttcaaat 1465  T
355 ccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaatt 433  Q
    || || || | ||| ||||| |||||  | |  ||||||| ||||||||| || ||||| |||||||||||||||||||    
1464 cctttagggagccatttttccttctccgcttcactctcattctctttcccctttttctctgggacaacccatatgaatt 1386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536; HSP #3
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 145 - 268
Target Start/End: Complemental strand, 10714 - 10591
Alignment:
145 ccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggcttccacgg 244  Q
    ||||| |||||||| || |||||||||||||| ||||| ||||||||  |||||| ||||||||||||||||||||||||||||||||| || |||||||    
10714 ccaatcccccgcacttgcgttatcaacttctcattgtaaaattgttctccatgcattggccacgtgatcattggaacccctgcactaaccgcctccacgg 10615  T
245 tggagttccacccgcaatgtgtca 268  Q
    |||| |||||||| ||||||||||    
10614 tggaattccacccacaatgtgtca 10591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 346 - 451
Target Start/End: Complemental strand, 10501 - 10396
Alignment:
346 tcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccgatg 445  Q
    ||||||||||| || || | ||| ||||| ||||| || |  ||||||| |||||||||||||||||| || ||||| ||||  |||| || ||||||||    
10501 tcttcaaatcctttcggtagccatttttctttctcctcttgactctcattctctttccctttcttctcaggaacaactcatacaaattcgtaacccgatg 10402  T
446 cttcta 451  Q
    ||||||    
10401 cttcta 10396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 83; Significance: 7e-39; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 163 - 452
Target Start/End: Original strand, 13448339 - 13448637
Alignment:
163 gttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggcttccacggtggagttccacccgcaat 262  Q
    |||||||  ||||| ||||||||||| ||  |||| || |||||||| ||||||||||| || |||||||| || || ||||| ||||||| ||||||||    
13448339 gttatcagtttctcattgtagaattgatctccatgaaccggccacgttatcattggaactcccgcactaacagcctctacggttgagttccccccgcaat 13448438  T
263 gtgtcaagaatgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgatca---------tcccgatattcctctcttcaaa 353  Q
    | ||||  ||| | || |  ||||||||||  || |||   || ||||||||||| ||||| |||||||         |||||||||| |||||||||||    
13448439 gcgtcataaatccccccactgcagggtggctcaatatcttaacctgtggggcccaacccctaatgatcaaacccttcttcccgatatttctctcttcaaa 13448538  T
354 tccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccgatgcttctat 452  Q
    |||||| || | ||||||||| ||||| || | ||||||||| ||||||||||||||||| || ||||||||||||||| ||||||| |||||||||||    
13448539 tcccttcggtaaccacttttctttctcttcttcgctctcatcttctttccctttcttctcaggaacaacccatatgaatgggtgaccggatgcttctat 13448637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 343 - 470
Target Start/End: Original strand, 13440365 - 13440492
Alignment:
343 ctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccg 442  Q
    |||||||| ||||||||||||| ||||||||| ||||| || |  |||||||| ||||||||||||||||| || ||||||||||||||| ||||||  |    
13440365 ctctcttcgaatccctttggcaaccacttttctttctcttcctcactctcatcttctttccctttcttctcaggaacaacccatatgaatgggtgactag 13440464  T
443 atgcttctattgcgcttgcaatctcata 470  Q
    |||||||||||||||  || ||||||||    
13440465 atgcttctattgcgcacgccatctcata 13440492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 172 - 470
Target Start/End: Original strand, 13454819 - 13455126
Alignment:
172 ttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggcttccacggtggagttccacccgcaatgtgtcaaga 271  Q
    ||||||||||||||||| ||  |||| ||||||||||| ||||||||||| ||    ||||| || || ||| | ||||||| ||||||||| ||||  |    
13454819 ttctcgttgtagaattgatctccatggactggccacgttatcattggaactcccatgctaacagcctctacgattgagttccccccgcaatgcgtcataa 13454918  T
272 atgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgatca---------tcccgatattcctctcttcaaatccctttgg 362  Q
    || | || |  |||||||| |  || |||   |||||||||||||| ||||| |||||||         || |||| ||  |||||||||||||||| ||    
13454919 atccccccactgcagggtgactcaatatcttaacttgtggggcccaacccctaatgatcaaaccctttttctcgatgtttttctcttcaaatcccttcgg 13455018  T
363 catccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccgatgcttctattgcgcttgca 462  Q
    || ||||||||  ||||| || | ||||||||| ||||||||||||||||| || ||||||||||||||  | ||||| | |||||||| || || |||     
13455019 caaccacttttgtttctcctcttcgctctcatcttctttccctttcttctccggaacaacccatatgaacggttgacctgctgcttctagtgagcatgcc 13455118  T
463 atctcata 470  Q
    ||||||||    
13455119 atctcata 13455126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 233
Target Start/End: Original strand, 13440185 - 13440246
Alignment:
172 ttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaac 233  Q
    ||||||||||||||||| ||  |||| || |||||||| ||||||||||| || ||||||||    
13440185 ttctcgttgtagaattgatctccatgaaccggccacgttatcattggaactcccgcactaac 13440246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 72; Significance: 2e-32; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 343 - 470
Target Start/End: Original strand, 28385499 - 28385626
Alignment:
343 ctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccg 442  Q
    ||||| |||||||||||||||| ||||||||| ||||| || | | ||||||| ||||||||||||||||| || ||||||||||||||| ||||||| |    
28385499 ctctcctcaaatccctttggcagccacttttctttctcttcttcgatctcatcttctttccctttcttctcaggaacaacccatatgaatgggtgacctg 28385598  T
443 atgcttctattgcgcttgcaatctcata 470  Q
    ||||||||| ||||| ||||||||||||    
28385599 atgcttctactgcgcatgcaatctcata 28385626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 343 - 470
Target Start/End: Original strand, 12540850 - 12540977
Alignment:
343 ctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccg 442  Q
    ||||| ||||||||||| |||||||||||||| ||||| || |   ||||||| ||||||||| ||||||| || ||||||||||||||| ||||||||     
12540850 ctctcctcaaatcccttcggcatccacttttctttctcttcttcagtctcatcttctttccctctcttctcaggaacaacccatatgaatgggtgaccca 12540949  T
443 atgcttctattgcgcttgcaatctcata 470  Q
     | |||||| ||| | ||||||||||||    
12540950 ttccttctactgcacatgcaatctcata 12540977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 68; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 162 - 329
Target Start/End: Complemental strand, 12641685 - 12641518
Alignment:
162 agttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggcttccacggtggagttccacccgcaa 261  Q
    |||||||| |||||| || ||||| |||||  | ||||||||||||||||||||||||| |||||||||||| || || ||   ||||||| ||||||||    
12641685 agttatcagcttctcattatagaactgttctccttgcactggccacgtgatcattggaatccctgcactaacagcctctaccaaggagttcgacccgcaa 12641586  T
262 tgtgtcaagaatgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgat 329  Q
    || |||| ||||||||| | ||||| ||||| ||||||||  ||||||||||||||| |||| |||||    
12641585 tgcgtcatgaatgcacccacagcagcgtggcttaaaatcattacttgtggggcccactccctaatgat 12641518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 343 - 467
Target Start/End: Complemental strand, 12641492 - 12641368
Alignment:
343 ctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccg 442  Q
    |||||||| ||||| || |||| ||||||||| ||||| || |  |||||||| | ||||||||||||||| || ||||||||||  |||| |||||| |    
12641492 ctctcttcgaatcctttaggcaaccacttttctttctcctcttcactctcatcttttttccctttcttctcaggaacaacccatacaaattcgtgacctg 12641393  T
443 atgcttctattgcgcttgcaatctc 467  Q
    |   ||||||| |||| ||||||||    
12641392 aattttctattccgctcgcaatctc 12641368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 1e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 343 - 470
Target Start/End: Complemental strand, 3417541 - 3417414
Alignment:
343 ctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccg 442  Q
    ||||| ||||||||||| |||| ||||||||| ||||| || | | ||||||| ||||| |||||||||||  | ||||||||||||||| |||||||||    
3417541 ctctcctcaaatcccttcggcaaccacttttctttctcttcttcgttctcatcttcttttcctttcttctcaagaacaacccatatgaatgggtgacccg 3417442  T
443 atgcttctattgcgcttgcaatctcata 470  Q
    ||||||||||||||  ||||||||||||    
3417441 atgcttctattgcgtatgcaatctcata 3417414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 55; Significance: 3e-22; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 343 - 453
Target Start/End: Complemental strand, 12483475 - 12483365
Alignment:
343 ctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccg 442  Q
    ||||| ||||||||||| |||| ||||||||| ||||| |||| ||||||||| || |||||||| ||||| || ||||||||||||||||  | |||||    
12483475 ctctcctcaaatcccttcggcaaccacttttctttctcctcatcgctctcatcttccttcccttttttctcaggaacaacccatatgaattttttacccg 12483376  T
443 atgcttctatt 453  Q
    |||||||||||    
12483375 atgcttctatt 12483365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 139 - 329
Target Start/End: Complemental strand, 12483694 - 12483504
Alignment:
139 tccacaccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcactaacggctt 238  Q
    ||||||||||| || ||||| | |||||| |  ||||| ||||| || |||||  | || || ||||||||||||||||||| |||||||||||| ||||    
12483694 tccacaccaatccctcgcacattagttatgagtttctcattgtaaaaatgttcaccgtgaaccggccacgtgatcattggaatccctgcactaaccgctt 12483595  T
239 ccacggtggagttccacccgcaatgtgtcaagaatgcaccaatagcagggtggcctaaaatcaccacttgtggggcccacccccttatgat 329  Q
    ||||    || ||||| || || || ||||  |||||||| |  ||||||||||  |||||||  || ||||| ||||||||||| |||||    
12483594 ccacaacagaattccatccacagtgagtcataaatgcacccactgcagggtggctcaaaatcagtacctgtggtgcccaccccctgatgat 12483504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 268
Target Start/End: Complemental strand, 12590407 - 12590270
Alignment:
131 caccaacctccacaccaataccccgcacctgagttatcaacttctcgttgtagaattgttcgtcatgcactggccacgtgatcattggaacccctgcact 230  Q
    ||||||| ||||| ||||| ||  |||| | ||||||||||||||| ||||| || |||||  ||| || |||||| |||||||| ||||  || |||||    
12590407 caccaacttccactccaattccatgcacatcagttatcaacttctcattgtaaaaatgttcaccattcaatggccatgtgatcatcggaattccagcact 12590308  T
231 aacggcttccacggtggagttccacccgcaatgtgtca 268  Q
    ||| || ||||||  ||| ||||| || ||||||||||    
12590307 aaccgcctccacgacggaattccatccacaatgtgtca 12590270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 343 - 452
Target Start/End: Complemental strand, 12590180 - 12590071
Alignment:
343 ctctcttcaaatccctttggcatccacttttcgttctcgtcattgctctcatcctctttccctttcttctcggggacaacccatatgaattggtgacccg 442  Q
    ||||||||||||||  | |||| ||| ||||  || || ||||  |||||||| || |||||||| |||||||| | |||||||| ||||| ||| || |    
12590180 ctctcttcaaatccactaggcaaccatttttgtttatcctcatcactctcatcttccttcccttttttctcgggaataacccatacgaattcgtggcctg 12590081  T
443 atgcttctat 452  Q
    ||||||||||    
12590080 atgcttctat 12590071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106128 times since January 2019
Visitors: 1319