View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk100-26 (Length: 676)

Name: R108-tnk100-26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk100-26
R108-tnk100-26
[»] chr2 (4 HSPs)
chr2 (487-676)||(10174046-10174235)
chr2 (1-109)||(10173935-10174050)
chr2 (29-109)||(9157014-9157101)
chr2 (58-109)||(127733-127784)
[»] chr7 (2 HSPs)
chr7 (251-451)||(38354922-38355122)
chr7 (178-229)||(38354848-38354900)
[»] chr5 (2 HSPs)
chr5 (61-108)||(32283693-32283740)
chr5 (60-108)||(39937906-39937954)
[»] chr8 (1 HSPs)
chr8 (60-108)||(4402287-4402335)
[»] chr1 (2 HSPs)
chr1 (60-106)||(1099893-1099939)
chr1 (61-110)||(24848427-24848476)


Alignment Details
Target: chr2 (Bit Score: 182; Significance: 5e-98; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 182; E-Value: 5e-98
Query Start/End: Original strand, 487 - 676
Target Start/End: Complemental strand, 10174235 - 10174046
Alignment:
487 agaaatcatgaaattcctatagttttgtttgaaataactccatatccataaaatacttctcaaaagttctcaatgaaggttgattggatatggtgataca 586  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
10174235 agaaatcatgaaattcctatagttttgtttgaaataactccatatccataaaatacttctcaaaagttctcaatgaagattgattggatatggtgataca 10174136  T
587 agtacaccagaaggggttcgtggcagtgtgtatagaatctagggagcaaaaagaggatgaggaaaaagaagagaggggtaatctagtata 676  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
10174135 agtacaccagaaggggttcgtggcagtgtgtatagaatctagggagcaaaaagaggatgaggaaaaagaagagaggtgtaatctagtata 10174046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 10174050 - 10173935
Alignment:
1 gtatatacggcgcatgatgaaatatttgagcttgattaatctaatgacttttgtttgtt-------gtggttcaccggtgaaggatttaacagaactctc 93  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||       ||||||||||||||| ||| |||||||||| |||    
10174050 gtatatacggtgcatgatgaaatatttgagcttgattaatctaatggctcttgtttgttgttcaaggtggttcaccggtgagggacttaacagaaccctc 10173951  T
94 accctagaatccacct 109  Q
    ||||||||||||||||    
10173950 accctagaatccacct 10173935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 29 - 109
Target Start/End: Complemental strand, 9157101 - 9157014
Alignment:
29 agcttgattaatctaatgacttttgtttgttgt-------ggttcaccggtgaaggatttaacagaactctcaccctagaatccacct 109  Q
    |||| |||||||||||| |||||||||||||||       ||||||||||||| |||||||| ||||| ||| |||||||||||||||    
9157101 agctcgattaatctaataacttttgtttgttgttcaaagtggttcaccggtgagggatttaatagaaccctcgccctagaatccacct 9157014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 109
Target Start/End: Original strand, 127733 - 127784
Alignment:
58 ttgtggttcaccggtgaaggatttaacagaactctcaccctagaatccacct 109  Q
    ||||| ||||||||||||||| ||||  |||| |||||||||||||||||||    
127733 ttgtgcttcaccggtgaaggacttaattgaaccctcaccctagaatccacct 127784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 157; Significance: 4e-83; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 157; E-Value: 4e-83
Query Start/End: Original strand, 251 - 451
Target Start/End: Original strand, 38354922 - 38355122
Alignment:
251 aaccattcaaaatatatagataagtgannnnnnnnaaacgaaaatatttcatataaaaactaaacaattatagcacatctagatgtgcaagagaatgatt 350  Q
    |||||||||||||||||||||||||||        ||| ||||| |||  |||||||||||||||||||||||||||||||||||||||||| |||||||    
38354922 aaccattcaaaatatatagataagtgattttttttaaaggaaaacattaaatataaaaactaaacaattatagcacatctagatgtgcaagaaaatgatt 38355021  T
351 aaataagttactagttcttataatatttcaattttatgatttggtcctaaatatatttaagttttagatgagtagatgacaaaattgtgcatatgttcct 450  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38355022 aaataagttactagttcttataatatttcaattttatgatttggtcctaaatatatttaagttttagatgagtagatgacaaaattgtgcatatgttcct 38355121  T
451 c 451  Q
    |    
38355122 c 38355122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 229
Target Start/End: Original strand, 38354848 - 38354900
Alignment:
178 tcctccaaatgtaagttagcacgact-tttattttattatgtctttgctaaga 229  Q
    |||| ||||||||||||||||||||| ||| ||||||||||||||||||||||    
38354848 tccttcaaatgtaagttagcacgactctttgttttattatgtctttgctaaga 38354900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000006; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 61 - 108
Target Start/End: Complemental strand, 32283740 - 32283693
Alignment:
61 tggttcaccggtgaaggatttaacagaactctcaccctagaatccacc 108  Q
    |||| ||||||||| ||||||||||| |||||||||||||||||||||    
32283740 tggtccaccggtgagggatttaacaggactctcaccctagaatccacc 32283693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 60 - 108
Target Start/End: Original strand, 39937906 - 39937954
Alignment:
60 gtggttcaccggtgaaggatttaacagaactctcaccctagaatccacc 108  Q
    ||||| ||||||||| ||| ||||| |||| ||||||||||||||||||    
39937906 gtggtccaccggtgagggacttaactgaaccctcaccctagaatccacc 39937954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 60 - 108
Target Start/End: Original strand, 4402287 - 4402335
Alignment:
60 gtggttcaccggtgaaggatttaacagaactctcaccctagaatccacc 108  Q
    ||||||||||||||| ||| |||| ||||| ||||||||||||||||||    
4402287 gtggttcaccggtgagggacttaatagaaccctcaccctagaatccacc 4402335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000006; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 1099939 - 1099893
Alignment:
60 gtggttcaccggtgaaggatttaacagaactctcaccctagaatcca 106  Q
    |||||||| |||||| ||| |||| ||||||||||||||||||||||    
1099939 gtggttcatcggtgagggacttaatagaactctcaccctagaatcca 1099893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 61 - 110
Target Start/End: Original strand, 24848427 - 24848476
Alignment:
61 tggttcaccggtgaaggatttaacagaactctcaccctagaatccacctt 110  Q
    |||| ||||||||| ||| |||| ||||| ||||||||||||||||||||    
24848427 tggtacaccggtgagggacttaatagaaccctcaccctagaatccacctt 24848476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 362088 times since January 2019
Visitors: 488