View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk100-42 (Length: 298)

Name: R108-tnk100-42
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk100-42
R108-tnk100-42
[»] chr4 (2 HSPs)
chr4 (31-298)||(1230064-1230331)
chr4 (3-37)||(1230029-1230063)


Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 31 - 298
Target Start/End: Complemental strand, 1230331 - 1230064
Alignment:
31 attaatctcaccaaattaaagagagtatatcgtaagtatttttcttttctatatgctccattgtcatattaaatttgtttgcaaattctaactactattt 130  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1230331 attaatctcaccaaattaaagagagtatatcgtaagtattttccttttctatatgctccattgtcatattaaatttgtttgcaaattctaactactattt 1230232  T
131 aatttcattttagtaactcaatcctcacatttaaaaatatataccaatatattgtttgattcattttattgacattgaagagatacaaacaatagaaaaa 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1230231 aatttcattttagtaactcaatcctcacatttaaaaatatataccaatatattgtttgattcattttattgacattgaagagatacaaacaatagaaaaa 1230132  T
231 cttccattttgcaatgaaaatagtggtaccttgctacacctctgtattttgagactcctctagaaaat 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1230131 cttccattttgcaatgaaaatagtggtaccttgctacacctctgtattttgagactcctctagaaaat 1230064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 3 - 37
Target Start/End: Complemental strand, 1230063 - 1230029
Alignment:
3 ccactgctttttctacaaatcgaaaactattaatc 37  Q
    |||||||||||||||||||||||||||||||||||    
1230063 ccactgctttttctacaaatcgaaaactattaatc 1230029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108467 times since January 2019
Visitors: 1329