View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk100-47 (Length: 602)

Name: R108-tnk100-47
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk100-47
R108-tnk100-47
[»] chr3 (4 HSPs)
chr3 (1-293)||(39091074-39091367)
chr3 (463-602)||(39090939-39091078)
chr3 (291-327)||(39090858-39090894)
chr3 (252-293)||(35610928-35610969)
[»] chr7 (1 HSPs)
chr7 (252-293)||(35130645-35130686)
[»] chr4 (1 HSPs)
chr4 (252-293)||(27510480-27510521)


Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-150; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-150
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 39091074 - 39091367
Alignment:
1 agcattatacaagagctttaaaagatttgctgccaaatgggcatgtcaactctattgcagcataataatagcctttgggcatgtccactagttcaatcta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
39091074 agcattatacaagagctttaaaagatttgctgccaaatgggcatgtcaactctattgcagcataataatagcctttgggcatgtccactcgttcaatcta 39091173  T
101 gaggattcatacaaaaactattactctttctatctaaaatattgaagagtattttgcttaactgttgaaaagaatgatttactccatagttttattattt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39091174 gaggattcatacaaaaactattactctttctatctaaaatattgaagagtattttgcttaactgttgaaaagaatgatttactccatagttttattattt 39091273  T
201 aactaccgtgtaattgagtactagagataatatttgcagttatattactt-aaagtgttatgaaacatgatatcccatgaagaaatgagagaaa 293  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||    
39091274 aactaccgtgtaattgagtactagagatgatatttgcagttatattacttaaaagtgttatgaaacatgatatccaatgaaggaatgagagaaa 39091367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 140; E-Value: 5e-73
Query Start/End: Original strand, 463 - 602
Target Start/End: Original strand, 39090939 - 39091078
Alignment:
463 aattgaaaggccccactccttcactaacttggattcttatattatggtgtttttctctaactttgattattttgtttacagaggattaccctactcctta 562  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39090939 aattgaaaggccccactccttcactaacttggattcttatattatggtgtttttctctaactttgattattttgtttacagaggattaccctactcctta 39091038  T
563 accagattgcaatatggtacaatgtttgtgtacaaagcat 602  Q
    ||||||||||||||||||||||||||||||||||||||||    
39091039 accagattgcaatatggtacaatgtttgtgtacaaagcat 39091078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 291 - 327
Target Start/End: Original strand, 39090858 - 39090894
Alignment:
291 aaatgagtcttgagtagtggattgtcaatgtaaatgg 327  Q
    |||||||||||||||||||||||||||||||||||||    
39090858 aaatgagtcttgagtagtggattgtcaatgtaaatgg 39090894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 252 - 293
Target Start/End: Complemental strand, 35610969 - 35610928
Alignment:
252 aagtgttatgaaacatgatatcccatgaagaaatgagagaaa 293  Q
    |||||||| |||||||||||||| |||||| |||||||||||    
35610969 aagtgttaggaaacatgatatccaatgaaggaatgagagaaa 35610928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 252 - 293
Target Start/End: Complemental strand, 35130686 - 35130645
Alignment:
252 aagtgttatgaaacatgatatcccatgaagaaatgagagaaa 293  Q
    |||||||| |||||||||||||| |||||| |||||||||||    
35130686 aagtgttaggaaacatgatatccaatgaaggaatgagagaaa 35130645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 252 - 293
Target Start/End: Original strand, 27510480 - 27510521
Alignment:
252 aagtgttatgaaacatgatatcccatgaagaaatgagagaaa 293  Q
    |||||||| |||||||||||||| |||||| |||||||||||    
27510480 aagtgttaggaaacatgatatccaatgaaggaatgagagaaa 27510521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176062 times since January 2019
Visitors: 1578