View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-1 (Length: 220)

Name: R108-tnk148-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-1
R108-tnk148-1
[»] chr1 (2 HSPs)
chr1 (1-192)||(46695923-46696114)
chr1 (187-220)||(46696110-46696143)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 46696114 - 46695923
Alignment:
1 actacacgaggtacttgtaaaatctttttcctagtttatgttgtttatgattttgaattacgataattgatcgatgtttctgataactctattattcatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46696114 actacacgaggtacttgtaaaatctttttcctagtttatgttgtttatgattttgaattacgataattgatcgatgtttctgataactctattattcatt 46696015  T
101 gctaggaataaccttttggacaaatcaatgcataaagtttcatctgggaatgtaaataaaatatattcacatgaagaagctcttaagaattc 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46696014 gctaggaataaccttttggacaaatcaatgcataaagtttcatctgggaatgtaaataaaatatattcacatgaagaagctcttaagaattc 46695923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 220
Target Start/End: Complemental strand, 46696143 - 46696110
Alignment:
187 gaattcacctgacccgatctatttaaaggactac 220  Q
    ||||||||||||||||||||||||||||||||||    
46696143 gaattcacctgacccgatctatttaaaggactac 46696110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126472 times since January 2019
Visitors: 1390