View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-10 (Length: 517)

Name: R108-tnk148-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-10
R108-tnk148-10
[»] chr4 (3 HSPs)
chr4 (86-426)||(33718327-33718666)
chr4 (2-91)||(33718763-33718852)
chr4 (471-517)||(33718720-33718766)


Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 86 - 426
Target Start/End: Original strand, 33718327 - 33718666
Alignment:
86 gaattcttctttctctttcgtcccctttttgtggcgtttttatatatttatttatattgtggtgaccaccc-----aaccccaccaccacgagatagtgc 180  Q
    ||||||| |||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||     ||||||||||||||||||||||||    
33718327 gaattctcctttctctttcgtcccctttttgtggcgtttttatat------ttatattgtggtgaccacccaacccaaccccaccaccacgagatagtgc 33718420  T
181 gtcatgccacacatcaaaatcctatctggtactactattacaaaaccccacgtgattaattaatccaagtttataccttttcataaaccaaaacccaacc 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||    
33718421 gtcatgccacacatcaaaatcctatctggtactactattacaaaaccccacgtgattaattaatccaagtttataccctttcaaaaaccaaaacccaacc 33718520  T
281 gtgtgggaacggtgtacacacctgcctcttacttgccacatcattcccataccgtatataaccaacgtcaaacctttgacttcatttcattttcaacgtc 380  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33718521 gtgtgggaacagtgtacacacctgcctcttacttgccacatcattcccataccgtatataaccaacgtcaaacctttgacttcatttcattttcaacgtc 33718620  T
381 ttctaaaccttaagcaaacgctttagacttcaacacaacaacaaca 426  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||    
33718621 ttctaaaccttaaacaaacgctttagacttcaacacaacaacaaca 33718666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 2 - 91
Target Start/End: Original strand, 33718763 - 33718852
Alignment:
2 tctccggctccacctcaaccgcaaactcattaccggaatttcatctcccggattccaccatcggaagcagcagcagcatggagcgaattc 91  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33718763 tctccggctccacctcaaccgcaaactcattaccggaatttcatctcccggattccaccatcggaagcagcagcagcatggagcgaattc 33718852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 471 - 517
Target Start/End: Original strand, 33718720 - 33718766
Alignment:
471 gatcaagaacaatccgtcattgtcaccgccctaaccaaagtcatctc 517  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||    
33718720 gatcaagaacaatccgtcattgtcaccgccctaaccaaagtcgtctc 33718766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175840 times since January 2019
Visitors: 1577