View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-11 (Length: 662)

Name: R108-tnk148-11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-11
R108-tnk148-11
[»] scaffold1221 (2 HSPs)
scaffold1221 (368-662)||(920-1213)
scaffold1221 (85-325)||(674-914)
[»] chr6 (2 HSPs)
chr6 (563-662)||(27857096-27857199)
chr6 (35-87)||(27857017-27857069)
[»] chr3 (1 HSPs)
chr3 (389-450)||(14566555-14566621)


Alignment Details
Target: scaffold1221 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: scaffold1221
Description:

Target: scaffold1221; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 368 - 662
Target Start/End: Complemental strand, 1213 - 920
Alignment:
368 aattcaaacctgaaattttattttttggtgataaattggatcttgtttcaaaatttcatccaactttctactatgatgcaggcaagtatgcatgtgttat 467  Q
    |||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||    
1213 aattcaaacctgaaatttcattttt-ggtgataaattggattttgtttcaaaatttcatacaactttctactatgatgcaagcaagtatgcatgtgttat 1115  T
468 gactgttttctttttaacagggtcttctgataaacatttcaggtgtagggaagagttggttacctttagaattttctaccagttgtctactacctaaaaa 567  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| || || |||||||||||||||    
1114 gactgttttctttttaacagggtcttctgataaacatttcaggtgtgggtaagagttggttacctttagaattttctagcaattttctactacctaaaaa 1015  T
568 tttgtcaggtactttaaggttgaactaaaaaggaaaactcacaggattactatgggatggatccaccgtaagctgcctaaatggtagatgagaac 662  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||    
1014 tttgtcaggtactttaaggttgaactaaaaaggaaaactcacaggattactatgtgatggatccactgtaagctgcctaaatggtagatgagaac 920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1221; HSP #2
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 85 - 325
Target Start/End: Complemental strand, 914 - 674
Alignment:
85 ttatgaataaggagatagaatgggatatgctgattcatgtagatgatgcaagtggcaagtccgttgctacgttcctccaaaggtaataatttatataaat 184  Q
    |||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
914 ttatgaataaggagttagaatgggatacgccgattcatgtagatgatgcaagtggcaagtccgttgctacgttcctccaaaggtaataatttatataaat 815  T
185 tgactgattccttttacccttatgcattcaataaatatctttgtttaacactatgagctcactatcaaagtattaagcccagaatgcaattatacagttt 284  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
814 tgactgattccttttacccttatgcattcaataaatatctttgtttaacactatgagctcactatcaaagtattaagcccagaatgcaattatacggttt 715  T
285 tgaatctaaaagtttgtttttaagaagcatcaactctttta 325  Q
    |||||| |||| ||||||||||||||||| |||||||||||    
714 tgaatccaaaaatttgtttttaagaagcaacaactctttta 674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 563 - 662
Target Start/End: Complemental strand, 27857199 - 27857096
Alignment:
563 aaaaatttgtcaggtactttaaggttgaactaaa--aaggaaaactcacag--gattactatgggatggatccaccgtaagctgcctaaatggtagatga 658  Q
    ||||||||| |||||||||| |||||||||||||  |||  ||||||||||  |||||||||| ||||||||||| | ||||||   |||||||||||||    
27857199 aaaaatttgccaggtactttgaggttgaactaaaggaagtgaaactcacagaggattactatgtgatggatccactgaaagctgttgaaatggtagatga 27857100  T
659 gaac 662  Q
    ||||    
27857099 gaac 27857096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 87
Target Start/End: Complemental strand, 27857069 - 27857017
Alignment:
35 ttcaaggctgaccggagagttccaggatgtgaagcttcccagcgaacttctta 87  Q
    ||||| |||||||||||||||| ||||||||||||||| || |||||||||||    
27857069 ttcaacgctgaccggagagttcgaggatgtgaagcttctcaacgaacttctta 27857017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 389 - 450
Target Start/End: Complemental strand, 14566621 - 14566555
Alignment:
389 tttttggtgataaattggatc-----ttgtttcaaaatttcatccaactttctactatgatgcaggc 450  Q
    ||||||||||||||||||||      |||||||||||||||||  ||||||||| ||||||||||||    
14566621 tttttggtgataaattggattgctttttgtttcaaaatttcatttaactttctattatgatgcaggc 14566555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105844 times since January 2019
Visitors: 1319