View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-13 (Length: 507)

Name: R108-tnk148-13
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-13
R108-tnk148-13
[»] chr6 (6 HSPs)
chr6 (220-507)||(30993425-30993703)
chr6 (1-214)||(30993702-30993911)
chr6 (251-507)||(30964645-30964895)
chr6 (251-475)||(30934468-30934686)
chr6 (55-214)||(30934816-30934975)
chr6 (50-209)||(30965019-30965179)


Alignment Details
Target: chr6 (Bit Score: 182; Significance: 4e-98; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 182; E-Value: 4e-98
Query Start/End: Original strand, 220 - 507
Target Start/End: Original strand, 30993425 - 30993703
Alignment:
220 tccaatcggttaagccaagttaatggtgtttggccttgaatatgagcagcaagagtcccattggacaggtactcatgtactagcaagcattccttttgat 319  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
30993425 tccaatcggttaagccaagttaatggtgtttggccttgaatatgagcagcgagagtaccattggacaggtactcatgtactagcaagcattccttttgat 30993524  T
320 gagtggttcatcgataaattgtaacaaggtttttatgtcgcatgtaatttaggaatgcggtttcattgatgaactgtttcaaattcaatatgctgtactt 419  Q
    ||||||||||||||||||||||| || ||  ||| |||| | |||||||||||||||| ||||||||| ||||||||      ||||||||| |||||||    
30993525 gagtggttcatcgataaattgtagcatgg--tttgtgtcccgtgtaatttaggaatgcagtttcattgttgaactgt------ttcaatatggtgtactt 30993616  T
420 gtcttcagtaaagtaatggactgcaatctcacaaccattcttaagttttccaaatctaactagagtataagaacaaaataataataat 507  Q
    ||||||||||||||||||||||  |||||||||||||||||| |||||||| |||| ||||||||||||||| | |||||||||||||    
30993617 gtcttcagtaaagtaatggactctaatctcacaaccattctttagttttcctaatcaaactagagtataagagc-aaataataataat 30993703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 165; E-Value: 5e-88
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 30993702 - 30993911
Alignment:
1 ataataactatcagtcacctatatttgttctgtgtcagtcatcttcatccatctctcctttaacttcaaatgttacttatgatgacttgcaacgttaaac 100  Q
    |||||||| |||||||||||  ||||| ||||||||||||| ||||||||    |||||||||||||||||||||||| |||||||||||||||||||||    
30993702 ataataaccatcagtcacctgaatttgctctgtgtcagtcagcttcatcc----ctcctttaacttcaaatgttacttgtgatgacttgcaacgttaaac 30993797  T
101 aatgttgtggcagtacatgtcggtttcaaacaatttccgcatatacacgggcttaaattgtaagcattatacacacactttctcttaaacacacctagca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||    
30993798 aatgttgtggcagtacatgtcggtttcaaacaatttccgcatatacaagggcttaaattgtaaacattatacacacactttctcttaaacacacctagca 30993897  T
201 agctacaacaattg 214  Q
    ||||||||||||||    
30993898 agctacaacaattg 30993911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 251 - 507
Target Start/End: Original strand, 30964645 - 30964895
Alignment:
251 ggccttgaatatgagcagcaagagtcccattggacaggtactcatgtactagcaagcattccttttgatgagtggttcatcgataaattgtaacaaggtt 350  Q
    |||||||||||||||||||||||||||||||||||| ||| || |||||||| | | ||||||||||||||||||   | | |||||| || || |||||    
30964645 ggccttgaatatgagcagcaagagtcccattggacacgtattcttgtactagaatggattccttttgatgagtggcataaccataaatcgtgactaggtt 30964744  T
351 tttatgtcgcatgtaatttaggaatgcggtttcattgatgaactgtttcaaattcaatatgctgtacttgtcttcagtaaagtaatggactgcaatctca 450  Q
    ||| | | ||||||||||||||||| | |||||||||||||| |||      ||||||||| |||||||||||||| | ||| | |||||||||||||||    
30964745 tttgtatggcatgtaatttaggaatacagtttcattgatgaattgt------ttcaatatgttgtacttgtcttcattgaagcattggactgcaatctca 30964838  T
451 caaccattcttaagttttccaaatctaactagagtataagaacaaaataataataat 507  Q
    | |||||||||||||||||| |||| || |||| ||||||||||||||| |||||||    
30964839 cgaccattcttaagttttcctaatcaaagtagattataagaacaaaatagtaataat 30964895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 251 - 475
Target Start/End: Original strand, 30934468 - 30934686
Alignment:
251 ggccttgaatatgagcagcaagagtcccattggacaggtactcatgtactagcaagcattccttttgatgagtggttcatcgataaattgtaacaaggtt 350  Q
    |||||||||||||||||||||||||||| ||||||||||| |||||||||| || | ||||||||||||||||||   | | |||||| ||||| |||||    
30934468 ggccttgaatatgagcagcaagagtcccgttggacaggtattcatgtactatcatggattccttttgatgagtggcataaccataaatcgtaactaggtt 30934567  T
351 tttatgtcgcatgtaatttaggaatgcggtttcattgatgaactgtttcaaattcaatatgctgtacttgtcttcagtaaagtaatggactgcaatctca 450  Q
    ||| ||| ||||||||||||||||||| | ||||||| ||||||||      |||||||||  |||||||| |||| ||||| | ||||||| |||||||    
30934568 tttgtgtggcatgtaatttaggaatgcagcttcattggtgaactgt------ttcaatatgtggtacttgttttcattaaagcattggactgtaatctca 30934661  T
451 caaccattcttaagttttccaaatc 475  Q
    |||||||||||||||||||| ||||    
30934662 caaccattcttaagttttcctaatc 30934686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 55 - 214
Target Start/End: Original strand, 30934816 - 30934975
Alignment:
55 ctcctttaacttcaaatgttacttatgatgacttgcaacgttaaacaatgttgtggcagtacatgtcggtttcaaacaatttccgcatatacacgggctt 154  Q
    |||| |||||||||||||||||||||||||||| |  || | |||| ||| |||| |||||||  | |||| |||| |  |||  |||||||  ||| ||    
30934816 ctccgttaacttcaaatgttacttatgatgactagagacatgaaacgatgatgtgacagtacacatgggttacaaatagcttctacatatactagggatt 30934915  T
155 aaattgtaagcattatacacacactttctcttaaacacacctagcaagctacaacaattg 214  Q
    | ||||||  ||||||||||| |||| ||| ||||||| |||| ||||||||||||||||    
30934916 atattgtagacattatacacatacttgctcataaacacgcctaccaagctacaacaattg 30934975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 50 - 209
Target Start/End: Original strand, 30965019 - 30965179
Alignment:
50 catctctcctttaacttcaaatgttacttatgatgacttgcaacgttaaacaatgttgtggcagtacatgtcggtttcaaacaattt-ccgcatatacac 148  Q
    |||| |||||||||||||||| ||||||||||||||||| | | ||||||| ||| |||||||||||| |   || ||||| ||||| || |||||| |     
30965019 catccctcctttaacttcaaacgttacttatgatgactttcgatgttaaacgatgatgtggcagtacacgcaagtatcaaataatttcccacatatataa 30965118  T
149 gggcttaaattgtaagcattatacacacactttctcttaaacacacctagcaagctacaac 209  Q
    ||| | | || |||| ||| || |||| | ||||||| |||||| |||| |||||||||||    
30965119 gggataatatcgtaaacatcatgcacatattttctctaaaacacgcctaccaagctacaac 30965179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106027 times since January 2019
Visitors: 1319