View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk148-14 (Length: 327)
Name: R108-tnk148-14
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-tnk148-14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 11 - 131
Target Start/End: Complemental strand, 39742794 - 39742674
Alignment:
Q |
11 |
ttaattgtttttgtctacggtggtgattatttatacattgaatctaaaggatggtgcttcaaacctcctatgatttatatttgtcttttctttctaacgt |
110 |
Q |
|
|
|||||||||||| |||| |||| |||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
39742794 |
ttaattgtttttatctatggtgctgattatttatacattgaatacaaatgatggtgcttcaaacctgctatgatttatatttgtcttttctttctaacgc |
39742695 |
T |
 |
Q |
111 |
tgcatcatgttacatgtatga |
131 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
39742694 |
tgcatcatgttacatgtatga |
39742674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 248 - 290
Target Start/End: Complemental strand, 39742898 - 39742856
Alignment:
Q |
248 |
aattgcaatttcaacccagatgaatccattgaaactttgtgta |
290 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
39742898 |
aattgcaattttaacccagatgaatccattgaaactttgtgta |
39742856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 176040 times since January 2019
Visitors: 1577