View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-14 (Length: 327)

Name: R108-tnk148-14
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-14
R108-tnk148-14
[»] chr5 (2 HSPs)
chr5 (11-131)||(39742674-39742794)
chr5 (248-290)||(39742856-39742898)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 11 - 131
Target Start/End: Complemental strand, 39742794 - 39742674
Alignment:
11 ttaattgtttttgtctacggtggtgattatttatacattgaatctaaaggatggtgcttcaaacctcctatgatttatatttgtcttttctttctaacgt 110  Q
    |||||||||||| |||| |||| ||||||||||||||||||||  ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||     
39742794 ttaattgtttttatctatggtgctgattatttatacattgaatacaaatgatggtgcttcaaacctgctatgatttatatttgtcttttctttctaacgc 39742695  T
111 tgcatcatgttacatgtatga 131  Q
    |||||||||||||||||||||    
39742694 tgcatcatgttacatgtatga 39742674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 248 - 290
Target Start/End: Complemental strand, 39742898 - 39742856
Alignment:
248 aattgcaatttcaacccagatgaatccattgaaactttgtgta 290  Q
    ||||||||||| |||||||||||||||||||||||||||||||    
39742898 aattgcaattttaacccagatgaatccattgaaactttgtgta 39742856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176040 times since January 2019
Visitors: 1577