View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-15 (Length: 1210)

Name: R108-tnk148-15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-15
R108-tnk148-15
[»] chr1 (6 HSPs)
chr1 (1-892)||(41890428-41891315)
chr1 (887-1206)||(41891314-41891639)
chr1 (1013-1203)||(41896893-41897085)
chr1 (1-207)||(41896685-41896891)
chr1 (663-892)||(41896030-41896269)
chr1 (384-546)||(41896436-41896598)
[»] chr5 (5 HSPs)
chr5 (1-203)||(22550619-22550821)
chr5 (1117-1203)||(22550530-22550617)
chr5 (657-727)||(22551904-22551974)
chr5 (814-892)||(22552070-22552148)
chr5 (428-471)||(22550823-22550866)
[»] chr2 (1 HSPs)
chr2 (657-727)||(43855182-43855252)


Alignment Details
Target: chr1 (Bit Score: 762; Significance: 0; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 762; E-Value: 0
Query Start/End: Original strand, 1 - 892
Target Start/End: Complemental strand, 41891315 - 41890428
Alignment:
1 aaaccatcanngatagcaatgtgaaatggtgctatttgtgtctatttcgtcaatgcaatatgttatttcccagttgcaatcattggatattgnacttttg 100  Q
    |||||||||  |||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||    
41891315 aaaccatcaaagatagcaatgtggaatggtgctatttgtgcctatttcatcaatgcaatatgttatttcccagttgcaatcattggatattggacttttg 41891216  T
101 gacaagatgttaatgataatatactaatgtcacttgaaaaaccttcatggcttattgcctctgctaacttgatggtattcatccatgttgttggtagcta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41891215 gacaagatgttaatgataatatactaatgtcacttgaaaaaccttcatggcttattgcctctgctaacttgatggtattcatccatgttgttggtagcta 41891116  T
201 tcaggtatcanctattaatgtaaaaccaattcctcaaatttgtgaaaatagtgtcaaatatttttgtgcaaatattttttcactgtcttttgtacaaata 300  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41891115 tcaggtatcaactattaatgtaaaaccaattcctcaaatttgtgaaaatagtgtcaaatatttttgtgcaaatattttttcactgtcttttgtacaaata 41891016  T
301 tttgaaaatgtcttaacgnnnnnnngtgattgaaagtgaaaacaaaagtgaaaatagaaaaagttttcagaaactaaacagatcttaaattttcttttct 400  Q
    ||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41891015 tttgaaaatgtcttaacgtttttttgtgattgaaagtgaaaacaaaagtgaaaatagaaaaagttttcagaaactaaacagatcttaaattttcttttct 41890916  T
401 gatcggtggggtaaaaatatattataggtttatgcaatgcctgtttttgatttgattgagaggatgatgatgcgaagattg-acttccctcccgggtgta 499  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||    
41890915 gatcggtgaggtaaaaatatattataggtttatgcaatgcctgtttttgatttgattgagaggatgatgatgcgaagattgaacttccctccc-ggtgta 41890817  T
500 gcgcttagacttgtagctcgatctgcttatgtaggtaagatgtcaaacctcgaggcggaaactaattttctgcagtatagatagaagaattattttcctc 599  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||     
41890816 gcgcttagacttgtagctcgatctgcttatgtaggtaagatgtcaaaactcgaggc-gaaactaattttctgcagtatagatagaagaattatttt-ctt 41890719  T
600 catgataggtctttgttgaaatggttcagcctttttacattattc-ttggagtcacttttcccattctttggtgatcttcttggattctttggtggattt 698  Q
    ||||||||||||||||||||| | ||||||  ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||    
41890718 catgataggtctttgttgaaacgtttcagc--ttttacattattctttggagtcactttt-ccattctttggtgatcttcttggattctttggtggattt 41890622  T
699 ggttttgctcccacttcatattttgtaaggctctcttgtcctctctattcttatgtcaaattgtcaatttaagatgaattgattctgaaactaaaaagtc 798  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
41890621 ggttttgctcccacttcatattttgtaaggctctcttgtcctctctattcttatgtcaaattgtcaatttaaaatgaattgattctgaaactaaaaagtc 41890522  T
799 aattattggcttgttaattgtttcagcttcccagcataatgtggatgataatcaagaaaccaaagaaattcagcatcaactggttcatcaattg 892  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41890521 aattattggcttgttaattgtttcagcttcctagcataatgtggatgataatcaagaaaccaaagaaattcagcatcaactggttcatcaattg 41890428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 887 - 1206
Target Start/End: Complemental strand, 41891639 - 41891314
Alignment:
887 caattgtatcggtactaatgcgccgaacccaatcagaactctacagttaagcgtgtgtaagctagagtattacaagacctcataaaaaattcatat-caa 985  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
41891639 caattgtatcggtactaatgtgccgaacccaatcagaactctacagttaagcgtgtgtaagctagagtattacaagacctcataaaaaattcatattcaa 41891540  T
986 ctaaagcct-gatat-gtggtgttttgac-gcagntattcaactatagcatgggtggcttgcttacctagaggccggattgacaatgt-agctangcaaa 1081  Q
    ||||||||| ||||| ||||||||||||  |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |    
41891539 ctaaagccttgatattgtggtgttttgagtgcagttattcaactatagcatgggtggcttgcttacctagaggccggattgacaatgttagctatgcata 41891440  T
1082 caanccaatcagcaaaattgatttattgttcagagtcttcaatgcacttggtcaaatatcatttgcatttgctggccatgcagtgacccttgaaattcaa 1181  Q
    ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41891439 caaaccaatcagcaaaactgatttattgttcagagtcttcaatgcacttggtcaaatatcatttgcatttgctggccatgcagtgacccttgaaattcaa 41891340  T
1182 gctac-aatccatcaacacctgaaaa 1206  Q
    ||||| | ||||||||||||||||||    
41891339 gctacgattccatcaacacctgaaaa 41891314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 108; E-Value: 1e-53
Query Start/End: Original strand, 1013 - 1203
Target Start/End: Complemental strand, 41897085 - 41896893
Alignment:
1013 gcagntattcaactatagcatgggtggcttgcttacctagaggccggattgacaatgt-agctangcaaacaanccaatcagcaaaattgatttattgtt 1111  Q
    |||| ||||||||||||||||||||||| |||||| ||||||| |||||||||||||| | ||| ||| |||| | ||||||||||| ||||||||||||    
41897085 gcagctattcaactatagcatgggtggcatgcttatctagaggtcggattgacaatgttaactatgcatacaagcaaatcagcaaaactgatttattgtt 41896986  T
1112 cagagtcttcaatgcacttggtcaaatatcatttgcatttgctggccatgcagtgacccttgaaattcaagctacaa-tccatcaacacctga 1203  Q
     |||||||||| ||||||||||||||| |||||||||||| ||||||| |||||||| || |||||||| ||||||| |||||||||||||||    
41896985 tagagtcttcagtgcacttggtcaaatctcatttgcattttctggccaagcagtgacactagaaattcaggctacaattccatcaacacctga 41896893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 106; E-Value: 2e-52
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 41896891 - 41896685
Alignment:
1 aaaccatcanngatagcaatgtgaaatggtgctatttgtgtctatttcgtcaatgcaatatgttatttcccagttgcaatcattggatattgnacttttg 100  Q
    ||||| |||  |||| ||||||| || ||||||||||||| ||||||  ||||||||||||| |||||||| ||||||| | | ||||||||  ||||||    
41896891 aaaccctcaaagataccaatgtggaaaggtgctatttgtgcctatttaatcaatgcaatatgctatttccctgttgcaaccttaggatattgggcttttg 41896792  T
101 gacaagatgttaatgataatatactaatgtcacttgaaaaaccttcatggcttattgcctctgctaacttgatggtattcatccatgttgttggtagcta 200  Q
    ||||||||||| ||||||| ||||| ||||||||||||| ||||||||||||| |||| |||||||| ||||||||||||||| ||||| ||||||||||    
41896791 gacaagatgttgatgataacatacttatgtcacttgaaagaccttcatggcttgttgcttctgctaatttgatggtattcatcaatgttcttggtagcta 41896692  T
201 tcaggta 207  Q
     ||||||    
41896691 ccaggta 41896685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 92; E-Value: 4e-44
Query Start/End: Original strand, 663 - 892
Target Start/End: Complemental strand, 41896269 - 41896030
Alignment:
663 ttctttggtgatcttcttggattctttggtggatttggttttgctcccacttcatattttgtaaggctctcttgtcc--------tctctattcttatgt 754  Q
    |||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||        ||||||| |||||||    
41896269 ttctttggagatcttcttgggttctttggtggatttggttttgctcccacgtcatattttgtaaggcactcttgtcctctcaatttctctatgcttatgt 41896170  T
755 caaattgtcaa--tttaagatgaattgattctgaaactaaaaagtcaattattggcttgttaattgtttcagcttcccagcataatgtggatgataatca 852  Q
    |||||||||||  ||| | ||||||| ||| | |||  ||||  | |||||||  ||||| |||| ||||||||||| || ||||||||| |||||||||    
41896169 caaattgtcaaatttttaaatgaattaattataaaatcaaaagatgaattattttcttgtgaattatttcagcttcctagtataatgtggttgataatca 41896070  T
853 agaaaccaaagaaattcagcatcaactggttcatcaattg 892  Q
    |||| |||| || |||||| ||||| ||||||||||||||    
41896069 agaagccaaggagattcagtatcaattggttcatcaattg 41896030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 384 - 546
Target Start/End: Complemental strand, 41896598 - 41896436
Alignment:
384 cttaaattttcttttctgatcggtggggtaaaaatatattataggtttatgcaatgcctgtttttgatttgattgagaggatgatgatgcgaagattga- 482  Q
    ||||||||||||||| ||||   ||| |  ||||||| |||||||||||||| ||||||||||| || ||||||||| ||| |||| | ||| ||||||     
41896598 cttaaattttcttttttgattaatggcgcgaaaatatgttataggtttatgccatgcctgttttcgacttgattgaggggacgatggttcgacgattgaa 41896499  T
483 cttccctcccgggtgtagcgcttagacttgtagctcgatctgcttatgtaggtaagatgtcaaa 546  Q
    |||||||||  | ||||||||||||||||||||||||||| || ||||||||||||||| ||||    
41896498 cttccctcctag-tgtagcgcttagacttgtagctcgatccgcctatgtaggtaagatggcaaa 41896436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 82; Significance: 4e-38; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 4e-38
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 22550619 - 22550821
Alignment:
1 aaaccatcanngatagcaatgtgaaatggtgctatttgtgtctatttcgtcaatgcaatatgttatttcccagttgcaatcattggatattgnacttttg 100  Q
    |||||||||   ||| ||||||| || ||||||||| ||| |||| || | ||||||||||||||||||||||||||| | |||||||||||  | ||||    
22550619 aaaccatcaaaaataccaatgtggaaaggtgctattggtgcctatgtcataaatgcaatatgttatttcccagttgcacttattggatattgggcatttg 22550718  T
101 gacaagatgttaatgataatatactaatgtcacttgaaaaaccttcatggcttattgcctctgctaacttgatggtattcatccatgttgttggtagcta 200  Q
    ||  ||||||| | |||||| | || ||||||||||||| |||  | ||||| ||||||||||||||||||||||||||||| ||||||||||| || ||    
22550719 gaagagatgttgaagataatgtgcttatgtcacttgaaagaccagcttggctcattgcctctgctaacttgatggtattcattcatgttgttggaagtta 22550818  T
201 tca 203  Q
    |||    
22550819 tca 22550821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 5e-25
Query Start/End: Original strand, 1117 - 1203
Target Start/End: Original strand, 22550530 - 22550617
Alignment:
1117 tcttcaatgcacttggtcaaatatcatttgcatttgctggccatgcagtgacccttgaaattcaagctacaa-tccatcaacacctga 1203  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||  | |||||||||||||| |||| |||||||||||||||    
22550530 tcttcaatgcacttggtcaaatttcatttgcatttgctggccatgcagtagcacttgaaattcaagcaacaattccatcaacacctga 22550617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 657 - 727
Target Start/End: Original strand, 22551904 - 22551974
Alignment:
657 ttcccattctttggtgatcttcttggattctttggtggatttggttttgctcccacttcatattttgtaag 727  Q
    ||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
22551904 ttccctttctttggcgatcttcttggcttctttggtggatttggttttgctcccacttcatattttgtaag 22551974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 814 - 892
Target Start/End: Original strand, 22552070 - 22552148
Alignment:
814 aattgtttcagcttcccagcataatgtggatgataatcaagaaaccaaagaaattcagcatcaactggttcatcaattg 892  Q
    |||||||||||||||| || ||||||||| | ||||||||||||||||||| ||| ||||||||||||||||| |||||    
22552070 aattgtttcagcttcctagtataatgtggctaataatcaagaaaccaaagagatttagcatcaactggttcataaattg 22552148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000005
Query Start/End: Original strand, 428 - 471
Target Start/End: Original strand, 22550823 - 22550866
Alignment:
428 gtttatgcaatgcctgtttttgatttgattgagaggatgatgat 471  Q
    |||||||| |||||||||||||||||||||||||||||||||||    
22550823 gtttatgctatgcctgtttttgatttgattgagaggatgatgat 22550866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 657 - 727
Target Start/End: Original strand, 43855182 - 43855252
Alignment:
657 ttcccattctttggtgatcttcttggattctttggtggatttggttttgctcccacttcatattttgtaag 727  Q
    |||||||||||||||| ||| |||||||| ||||| ||||| |  |||||||||||  |||||||||||||    
43855182 ttcccattctttggtgctctccttggattttttggaggattggcatttgctcccacaacatattttgtaag 43855252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126739 times since January 2019
Visitors: 1391