View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-18 (Length: 770)

Name: R108-tnk148-18
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-18
R108-tnk148-18
[»] chr6 (19 HSPs)
chr6 (248-770)||(31171457-31171979)
chr6 (248-770)||(31145144-31145666)
chr6 (248-770)||(31189202-31189724)
chr6 (248-770)||(31201009-31201531)
chr6 (248-770)||(31224425-31224947)
chr6 (258-770)||(30992402-30992914)
chr6 (248-770)||(30960920-30961442)
chr6 (260-770)||(31229705-31230215)
chr6 (260-770)||(31214156-31214663)
chr6 (260-770)||(30955175-30955682)
chr6 (501-770)||(30944915-30945184)
chr6 (260-365)||(30945317-30945422)
chr6 (1-49)||(31145662-31145710)
chr6 (1-49)||(31171975-31172023)
chr6 (1-49)||(31201527-31201575)
chr6 (1-45)||(31189720-31189764)
chr6 (1-49)||(31224381-31224429)
chr6 (1-49)||(30944871-30944919)
chr6 (1-49)||(30955131-30955179)
[»] chr3 (1 HSPs)
chr3 (41-251)||(45259177-45259387)
[»] chr8 (2 HSPs)
chr8 (475-768)||(44035593-44035886)
chr8 (265-340)||(44036030-44036105)
[»] chr1 (16 HSPs)
chr1 (626-761)||(49714331-49714466)
chr1 (484-761)||(49683080-49683357)
chr1 (640-761)||(49710689-49710811)
chr1 (640-761)||(49215352-49215473)
chr1 (670-721)||(49725146-49725197)
chr1 (111-194)||(52968533-52968616)
chr1 (491-532)||(10906998-10907039)
chr1 (491-532)||(10930881-10930922)
chr1 (491-532)||(10993085-10993126)
chr1 (111-188)||(17589674-17589751)
chr1 (501-554)||(49215559-49215612)
chr1 (491-531)||(11041245-11041285)
chr1 (467-550)||(49725317-49725400)
chr1 (501-572)||(49728717-49728788)
chr1 (481-527)||(9125105-9125151)
chr1 (491-532)||(11026541-11026582)
[»] chr7 (3 HSPs)
chr7 (111-193)||(17200704-17200786)
chr7 (643-715)||(31618457-31618529)
chr7 (481-548)||(31614566-31614633)


Alignment Details
Target: chr6 (Bit Score: 499; Significance: 0; HSPs: 19)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 499; E-Value: 0
Query Start/End: Original strand, 248 - 770
Target Start/End: Original strand, 31171457 - 31171979
Alignment:
248 aattcattgtaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctcct 347  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31171457 aattcattgtaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctcct 31171556  T
348 tgcaatctcatcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 447  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31171557 tgcaatctcatcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 31171656  T
448 gtgtgacttgcatcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 547  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
31171657 gtgtgacttgcatcagcaatgatgtttttcctccctccaaccatttctagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 31171756  T
548 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtcc 647  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||    
31171757 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctgacattgaaataatgctctcttgttttggacagagttttgcaagtcc 31171856  T
648 aaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtac 747  Q
    ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31171857 aaaatctgaaatctttggacataagttttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtac 31171956  T
748 tctaacccacgagctatcccttt 770  Q
    |||| ||||||||||||||||||    
31171957 tctagcccacgagctatcccttt 31171979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 487; E-Value: 0
Query Start/End: Original strand, 248 - 770
Target Start/End: Original strand, 31145144 - 31145666
Alignment:
248 aattcattgtaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctcct 347  Q
    |||||||  ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31145144 aattcatgttaacttctaacatttcaataactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctcct 31145243  T
348 tgcaatctcatcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 447  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31145244 tgcaatctcatcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 31145343  T
448 gtgtgacttgcatcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 547  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
31145344 gtgtgacttgcatcagcaatgatgtttttcctccctccaaccatttctagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 31145443  T
548 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtcc 647  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||    
31145444 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctgacattgaaataatgctctcttgttttggacagagttttgcaagtcc 31145543  T
648 aaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtac 747  Q
    ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31145544 aaaatctgaaatctttggacataagttttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtac 31145643  T
748 tctaacccacgagctatcccttt 770  Q
    |||| ||||||||||||||||||    
31145644 tctagcccacgagctatcccttt 31145666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 447; E-Value: 0
Query Start/End: Original strand, 248 - 770
Target Start/End: Original strand, 31189202 - 31189724
Alignment:
248 aattcattgtaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctcct 347  Q
    |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
31189202 aattcatgttaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaattgtcattctcct 31189301  T
348 tgcaatctcatcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 447  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31189302 tgcaatctcgtcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 31189401  T
448 gtgtgacttgcatcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31189402 gtgtgacttgcatcagcaataatgtttttcctcccaccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 31189501  T
548 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtcc 647  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||  ||||||||||||||||||||||||    
31189502 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctgtcatcgaaataatgctctctttttttggacagagttttgcaagtcc 31189601  T
648 aaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtac 747  Q
    ||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||||    
31189602 aaaatctgaaatttttggacataaattctcatctaaaagaatgttatgtggttttatgtcgaaatgtaaaattcttgtggtacatcctctatgcaagtac 31189701  T
748 tctaacccacgagctatcccttt 770  Q
    ||||  ||||| |||||||||||    
31189702 tctagtccacgggctatcccttt 31189724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 248 - 770
Target Start/End: Original strand, 31201009 - 31201531
Alignment:
248 aattcattgtaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctcct 347  Q
    |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
31201009 aattcatgttaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaattgtcattctcct 31201108  T
348 tgcaatctcatcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 447  Q
    ||||||||  |||||||||||||||||||| ||||||||||||| |||| | |||||||| ||||||||||||||||| || |||||||||||||||||     
31201109 tgcaatcttgtcttcttctgtatccataactccatcaggtctcaaattactaccaagctcaagcctattgtatacccagtgaggaaagtatatctcactt 31201208  T
448 gtgtgacttgcatcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 547  Q
    ||| |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||    
31201209 gtgagacttgcatcagcattaatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcggacttgtatgaaactcctccaa 31201308  T
548 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtcc 647  Q
    ||||||||||||||| ||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||     ||||||| ||||||||||||||    
31201309 aatgtctattccacatttctggagctacatatcccatagtccctctttgatctgacatcgaaataatgctctcgttccttggacaaagttttgcaagtcc 31201408  T
648 aaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtac 747  Q
    ||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
31201409 aaaatctgaaatctttggacaaaaattctcatctaaaagaatattatgtggttttatgtcgaaatgtaaaattcgagtggtacatcctctatgcaagtac 31201508  T
748 tctaacccacgagctatcccttt 770  Q
    ||||  ||||||||||| |||||    
31201509 tctagtccacgagctattccttt 31201531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 248 - 770
Target Start/End: Complemental strand, 31224947 - 31224425
Alignment:
248 aattcattgtaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctcct 347  Q
    |||||||  |||| |||||||||||||||||||||||||||||||| |||||| | ||||| |||||||| ||||| ||||| ||||| |||||||||||    
31224947 aattcatgctaacatctaacatttcaatcactttactcattgtaggcctatcattaggaaacgtttgaatacaccacaaacctacaatggtcattctcct 31224848  T
348 tgcaatctcatcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 447  Q
    |||||||| |||||||||||||||||| |  ||||||||||| | || | |  ||||||| ||||| |||||||||||||| ||||| |||||||||||     
31224847 tgcaatcttatcttcttctgtatccattattccatcaggtctaaaatcactagcaagctcaagccttttgtatacccaatgaggaaaatatatctcactt 31224748  T
448 gtgtgacttgcatcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 547  Q
    ||| |||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||    
31224747 gtgcgacttgcatcagcattaatgtttttcctccctccaaccatttccagcaatatcattccataactataaacatcagacttgtgtgaaactcctccaa 31224648  T
548 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtcc 647  Q
    ||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||| |||||| |||    |  |||| ||||||||||||||    
31224647 aatgtctattccacacttctggagctacataccccattgttcctctttgatctgacattgaaacaatgctttctttcctgagacatagttttgcaagtcc 31224548  T
648 aaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtac 747  Q
    ||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||    
31224547 aaaatctgaaatcttcggacataaattatcatctaaaaggatgttgtgtggttttatgtcaaaatgtaaaattctagtggtacatcctccatgcaagtac 31224448  T
748 tctaacccacgagctatcccttt 770  Q
    ||||  |||||||||||||||||    
31224447 tctagtccacgagctatcccttt 31224425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 258 - 770
Target Start/End: Complemental strand, 30992914 - 30992402
Alignment:
258 aacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctccttgcaatctca 357  Q
    |||||||||||||||||  ||||||||||||||||||||  || | |||||||||||||| ||||| |||| |||||| ||||| ||| |||||||||||    
30992914 aacttctaacatttcaactactttactcattgtaggtctgccattaggaaatgtttgaatacaccacaaactcacaatggtcatcctctttgcaatctca 30992815  T
358 tcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcactagtgtgacttg 457  Q
    |||||||| |||||||| |||||||||||||||| || | | ||||| || |||||||||||||||||||| ||||||||||||||||| ||||||||||    
30992814 tcttcttccgtatccattaccccatcaggtctcaaataactaccaagttcaagcctattgtatacccaatgaggaaagtatatctcacttgtgtgacttg 30992715  T
458 catcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtctatt 557  Q
    |||| ||| | || |||||||  || || |||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
30992714 catccgcattaatatttttccgtccacccaccatttctaacaacatcattccataactataaacatcagacttgtgtgaaactcctccaaaatgtctatt 30992615  T
558 ccacacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtccaaagtctgaa 657  Q
    ||||||||||||||||||||| |||||||||||||||||||| | ||| |||| |||||| |||   ||  | || || ||||| |||||||| |||||     
30992614 ccacacttctggagctacataccccattgtccctctttgatccgacatcgaaacaatgctgtctttcttcaggcaaagctttgccagtccaaaatctgag 30992515  T
658 atctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtactctaacccac 757  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |||| |||||    
30992514 atctttggacaaaaattctcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggcacatcctctatgcaaatattctagcccac 30992415  T
758 gagctatcccttt 770  Q
    | |||||||||||    
30992414 gggctatcccttt 30992402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 248 - 770
Target Start/End: Complemental strand, 30961442 - 30960920
Alignment:
248 aattcattgtaacttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctcct 347  Q
    |||||||  ||||||||||||||||||  ||||||||||||||||| ||  || | |||||||||||||| ||||| ||||||||||| ||||||||| |    
30961442 aattcatgttaacttctaacatttcaactactttactcattgtaggcctgccattaggaaatgtttgaatacaccacaaacccacaatggtcattctctt 30961343  T
348 tgcaatctcatcttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcacta 447  Q
    ||||||||||| ||||||||||||  | |||||||||||||||| || | | ||||| || |||||||||||||||||||| |||||||||||||||||     
30961342 tgcaatctcattttcttctgtatcagttaccccatcaggtctcaaatcactaccaagttcaagcctattgtatacccaatgaggaaagtatatctcactt 30961243  T
448 gtgtgacttgcatcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaa 547  Q
    |||||||||||||| ||| | || |||||||  || || |||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||    
30961242 gtgtgacttgcatccgcattaatatttttccgtccacccaccatttctaacaacatcattccataactataaacatcagacttgtgtgaaactcctccaa 30961143  T
548 aatgtctattccacacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtcc 647  Q
    ||||||||||||||||||| ||||||||||| |||||||||||||||||||| | ||| |||| |||||| |||   ||  | || || ||||| |||||    
30961142 aatgtctattccacacttcaggagctacataccccattgtccctctttgatccgacatcgaaacaatgctgtctttcttcaggcaaagctttgccagtcc 30961043  T
648 aaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtac 747  Q
    ||| ||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||     
30961042 aaaatctgagatctttggacaaaaattctcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtagcacatcctctatgcaaatat 30960943  T
748 tctaacccacgagctatcccttt 770  Q
    |||| |||||| |||||||||||    
30960942 tctagcccacgggctatcccttt 30960920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 260 - 770
Target Start/End: Complemental strand, 31230215 - 31229705
Alignment:
260 cttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctccttgcaatctcatc 359  Q
    |||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||| ||||| |||| |||||||||||| |||||    
31230215 cttctaacatttcaatcactctactcattgttggtctatcatttggaaatgtttgaatgcaccataaacctacaatggtcaatctccttgcaatttcatc 31230116  T
360 ttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcactagtgtgacttgca 459  Q
    |||||| |   | || ||  | || ||||||| || | |||  || || ||  | |||||||||||||| ||||||||||||||||| || |||||||||    
31230115 ttcttccgagacaatcacttcgtccggtctcaaatcattgcgtagatcaagattcttgtatacccaatgaggaaagtatatctcacttgtttgacttgca 31230016  T
460 tcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtctattcc 559  Q
    || ||  | |||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| ||||| ||||||| |||||||| | ||||||    
31230015 tcggcgttaatgtttttcctcccaccaaccatttctagcaacatcattccataactataaacgtcagacttgtgcgaaactcatccaaaatttatattcc 31229916  T
560 acacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtccaaagtctgaaat 659  Q
    | |  || ||||||||||| ||||||||||||||    |||| ||| |||||||||||||||   ||  | || ||| ||| ||||||||| ||||| ||    
31229915 ataactcaggagctacataccccattgtccctctagcgtctgacatagaaataatgctctctttcttatggcaaagtcttgaaagtccaaaatctgatat 31229816  T
660 ctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtactctaacccacga 759  Q
    ||||||||| ||||| |||| ||| || |||||||||||||| |||||||||||||| |||| |||| |||||||  ||||||||||||| | ||| |||    
31229815 ctttggacaaaaattctcatataagaggatgttatgtggtttgatgtcaaaatgtaagattcaagtgctacatcccttatgcaagtactcaagccctcga 31229716  T
760 gctatcccttt 770  Q
    |||||||||||    
31229715 gctatcccttt 31229705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 169; E-Value: 3e-90
Query Start/End: Original strand, 260 - 770
Target Start/End: Complemental strand, 31214663 - 31214156
Alignment:
260 cttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctccttgcaatctcatc 359  Q
    |||||||||||||||| ||| ||||||||| |||||||||| |||||| |||||||||||||||||| || || || ||||||||| |||| || |||||    
31214663 cttctaacatttcaataactctactcattgcaggtctatcatttggaagtgtttgaatgcaccataatcctactatggtcattctctttgcgatgtcatc 31214564  T
360 ttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcactagtgtgacttgca 459  Q
     |||   ||  | || ||  ||||  |||||| || |||| | || || | ||| |||||||||||||  ||||||||| ||||||| || |||||||||    
31214563 atct---gtggcaatcacttcatcgtgtctcaaatcagtgtctagatcaaaccttttgtatacccaatcaggaaagtatttctcacttgtatgacttgca 31214467  T
460 tcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtctattcc 559  Q
    |  ||| | ||||||||||| ||||| |  ||||||| |||||||||||| ||||||||||||||||| ||||  ||||| |||||||| | ||||||||    
31214466 ttggcactaatgtttttccttcctccgattatttccaacaacatcattccgtaactataaacatcagacttgtacgaaacgcctccaaagtttctattcc 31214367  T
560 acacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtccaaagtctgaaat 659  Q
    |||  || ||||||||||||||||| || |||||   | ||| ||| ||||||||||| |||   ||  |||| ||| ||||||||||||| ||||| ||    
31214366 acaactcaggagctacatatcccatcgttcctctagcacctgacatcgaaataatgctttctttcttgagacaaagtcttgcaagtccaaaatctgatat 31214267  T
660 ctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtactctaacccacga 759  Q
    ||||||||| |||||||||||||| | ||| |||||||||||||| ||||||||||||||||||||  | ||||||||||||| |||||| ||||| |||    
31214266 ctttggacaaaaattttcatctaataaaatattatgtggttttatatcaaaatgtaaaattcgagtactgcatcctctatgcaggtactccaaccctcga 31214167  T
760 gctatcccttt 770  Q
    |||||||||||    
31214166 gctatcccttt 31214156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 161; E-Value: 2e-85
Query Start/End: Original strand, 260 - 770
Target Start/End: Complemental strand, 30955682 - 30955175
Alignment:
260 cttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctccttgcaatctcatc 359  Q
    |||| ||||||||||||||| |||||||||| |||| |||| |||| ||||||||||||||||||||||| ||||| |||||||   ||||||||||||     
30955682 cttccaacatttcaatcactctactcattgttggtcgatcatttggcaatgtttgaatgcaccataaaccaacaatggtcattccttttgcaatctcatt 30955583  T
360 ttcttctgtatccataaccccatcaggtctcagattagtgccaagctctagcctattgtatacccaatgtggaaagtatatctcactagtgtgacttgca 459  Q
    ||||||  |  |||| ||    |||||||||| || | |  |    |||||| ||||||||| ||||| |||||| ||   ||| ||||| ||| ||| |    
30955582 ttcttcaatggccatcactatgtcaggtctcaaatcactctccttttctagcttattgtatatccaatctggaaaata---ctcgctagtttgatttgta 30955486  T
460 tcagcaatgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtctattcc 559  Q
    | | ||   || || || ||| |||||||||| || |  | ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||    
30955485 ttaacatcaatattgtttctcactccaaccatctctaaaagcatcattccataactataaacatcagacttgtgtgaaactcctccaaattgtctattcc 30955386  T
560 acacttctggagctacatatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtccaaagtctgaaat 659  Q
    | |||||||||||||||||||| | ||| ||||||  || || |||  | ||| ||||||||   |   ||||||| |||||||||||||| ||||||||    
30955385 atacttctggagctacatatccgactgttcctcttgcatttgacatgaatatagtgctctctttctcgagacagagctttgcaagtccaaaatctgaaat 30955286  T
660 ctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtactctaacccacga 759  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||  ||||||| |||||||| ||||| || || |||    
30955285 ctttggacataaattttcatctaaaagaatgttatgtggttttatatcaaaatgtaaaatccgggtattacatcccctatgcaaatactccaaacctcga 30955186  T
760 gctatcccttt 770  Q
    |||||||||||    
30955185 gctatcccttt 30955175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 138; E-Value: 1e-71
Query Start/End: Original strand, 501 - 770
Target Start/End: Complemental strand, 30945184 - 30944915
Alignment:
501 catcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtctattccacacttctggagctacatatcccattgtccctctttgatct 600  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||| | ||| ||||||  || |    
30945184 catcattccataactataaacatcagacttgtgtgaaactcctccaaattgtctattccatacttctggagctacatatccgactgttcctcttgcattt 30945085  T
601 ggcattgaaataatgctctctggttttggacagagttttgcaagtccaaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggtt 700  Q
    | |||  ||||| ||||||||   ||  ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||    
30945084 gacatgaaaatagtgctctctttcttgagacagagctttgcaagtccaaaatctgaaatctttggacataaattttcatctaaaagaatgttatgcggtt 30944985  T
701 ttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtactctaacccacgagctatcccttt 770  Q
    ||||||||||||||||||| ||  |  |||| || |||||||| ||||| || |  ||||||||||||||    
30944984 ttatgtcaaaatgtaaaatccggatattacaccccctatgcaaatactccaaacttcgagctatcccttt 30944915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 260 - 365
Target Start/End: Complemental strand, 30945422 - 30945317
Alignment:
260 cttctaacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtcattctccttgcaatctcatc 359  Q
    |||| ||||||||||||||| |||||||||| |||| |||| |||| ||||||||||||||||||||||| |||||||||||||   ||||||||||||     
30945422 cttccaacatttcaatcactctactcattgttggtcgatcatttggcaatgtttgaatgcaccataaaccaacaatagtcattccttttgcaatctcatt 30945323  T
360 ttcttc 365  Q
    ||||||    
30945322 ttcttc 30945317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 31145662 - 31145710
Alignment:
1 ccttttgcaatttgatacaaattctcccaactcaaagatgcaattgttt 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
31145662 ccttttgcaatttgatacaaattctcccaactcaaagatgcaattgttt 31145710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 31171975 - 31172023
Alignment:
1 ccttttgcaatttgatacaaattctcccaactcaaagatgcaattgttt 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
31171975 ccttttgcaatttgatacaaattctcccaactcaaagatgcaattgttt 31172023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 31201527 - 31201575
Alignment:
1 ccttttgcaatttgatacaaattctcccaactcaaagatgcaattgttt 49  Q
    ||||||||||||||||||||||| |||||||||||||||||||| ||||    
31201527 ccttttgcaatttgatacaaattatcccaactcaaagatgcaatggttt 31201575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 31189720 - 31189764
Alignment:
1 ccttttgcaatttgatacaaattctcccaactcaaagatgcaatt 45  Q
    ||||||||||||||||||||||| |||||||||||||||| ||||    
31189720 ccttttgcaatttgatacaaattatcccaactcaaagatgtaatt 31189764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31224429 - 31224381
Alignment:
1 ccttttgcaatttgatacaaattctcccaactcaaagatgcaattgttt 49  Q
    ||||||||||||| |||||| || |||||||||||||||||||||||||    
31224429 ccttttgcaattttatacaatttatcccaactcaaagatgcaattgttt 31224381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30944919 - 30944871
Alignment:
1 ccttttgcaatttgatacaaattctcccaactcaaagatgcaattgttt 49  Q
    ||||| ||||||||||||||||| |||||||| ||||||||||| ||||    
30944919 cctttggcaatttgatacaaattatcccaacttaaagatgcaatggttt 30944871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30955179 - 30955131
Alignment:
1 ccttttgcaatttgatacaaattctcccaactcaaagatgcaattgttt 49  Q
    ||||| ||||||||||| ||||| |||||||||||||||||||| ||||    
30955179 cctttggcaatttgatagaaattatcccaactcaaagatgcaatggttt 30955131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 41 - 251
Target Start/End: Original strand, 45259177 - 45259387
Alignment:
41 caattgttttgactgacaagaatgtatgacggggatctagggtccaaagtgacagtcaccagttcgaaattttggtccctgactttacacctcgctatca 140  Q
    |||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||    
45259177 caattgttttaactgacaagaatgtatgacgtggatctagggtccaaagtgacagtcaccagttcgaaattttggtccctgactttactcctcgctgtca 45259276  T
141 caatggtcgttgactcgagataaaatacaaaatactcattggatgtgtacctccaatagccattatagtccttaatgttaaaattggtcgttaaaaggtg 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
45259277 caatggtcgttgactcgagataaaatacaaaatactcattggatgtgtacctccaatagccattatagtccttaacgttaaaattggtcgttaaaaggtg 45259376  T
241 agatgacaatt 251  Q
    |||||||||||    
45259377 agatgacaatt 45259387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 3e-19; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 475 - 768
Target Start/End: Complemental strand, 44035886 - 44035593
Alignment:
475 ttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtctattccacacttctggagcta 574  Q
    |||| ||| ||||||||||| |||||||||||||| |||||||| |||||||| || |||||||| || || |||  | | ||  | ||||| ||||| |    
44035886 ttccgcccaccaaccatttctagcaacatcattccgtaactatagacatcagacttatgtgaaacgcccccgaaacttttgttgaaaacttcaggagcaa 44035787  T
575 catatcccattgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtccaaagtctgaaatctttggacataaatt 674  Q
    |||| || |  ||||||||    | || ||||||||||||||||||     |||  |  ||||| ||||||||||| || || ||||| ||||   || |    
44035786 catacccaacagtccctctagcgtttgacattgaaataatgctctcattgcttgtgcttagtttagcaagtccaaaatcagatatcttgggacggtaagt 44035687  T
675 ttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtactctaacccacgagctatccct 768  Q
    ||| || |||||||||||||||||||| ||||| ||||| ||||| | |||| | || ||| |||||||||||||||  || ||||||||||||    
44035686 ttcgtccaaaagaatgttatgtggtttaatgtcgaaatgaaaaatcctagtgttgcaccctttatgcaagtactctagtcctcgagctatccct 44035593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 265 - 340
Target Start/End: Complemental strand, 44036105 - 44036030
Alignment:
265 aacatttcaatcactttactcattgtaggtctatcacttggaaatgtttgaatgcaccataaacccacaatagtca 340  Q
    ||||| |||||||||||||| ||||||||||||| | | |||| ||||||||||||||| ||||| || |||||||    
44036105 aacatatcaatcactttacttattgtaggtctatgagtaggaattgtttgaatgcaccacaaaccaaccatagtca 44036030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 5e-18; HSPs: 16)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 626 - 761
Target Start/End: Complemental strand, 49714466 - 49714331
Alignment:
626 ttggacagagttttgcaagtccaaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagt 725  Q
    ||||||| | ||| |||||||| || |||||||| || ||||| |||| |||||| |  |  || ||||| ||||| |||||||||||||| |||| |||    
49714466 ttggacatactttagcaagtccgaaatctgaaattttaggacagaaatcttcatcaagtaatatattatgaggtttaatgtcaaaatgtaagattctagt 49714367  T
726 ggtacatcctctatgcaagtactctaacccacgagc 761  Q
    | |||| ||||| |||||||||||||||||||||||    
49714366 gttacagcctctgtgcaagtactctaacccacgagc 49714331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 484 - 761
Target Start/End: Complemental strand, 49683357 - 49683080
Alignment:
484 ccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtctattccacacttctggagctacatatccca 583  Q
    ||||||||||| |  | ||||||||||||||| || ||||| ||||||||||| || || ||||||||||||    |||  |||||||| | ||||||      
49683357 ccaaccatttctaaaaccatcattccataactgtagacatctgatttgtgtgacaccccaccaaaatgtctagagaacagctctggagcaatatatcctg 49683258  T
584 ttgtccctctttgatctggcattgaaataatgctctctggttttggacagagttttgcaagtccaaagtctgaaatctttggacataaattttcatctaa 683  Q
     |||||| |||  | |    ||||| | |||||| |||  | ||||||| | ||| ||||||||||| |||||||| |||||||| ||||  || || |     
49683257 gtgtcccccttgcaccaaatattgatacaatgctttcttttcttggacatattttagcaagtccaaaatctgaaatttttggacacaaatcatcgtcaag 49683158  T
684 aagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctatgcaagtactctaacccacgagc 761  Q
     |  || ||||| |||||||||||||||||||| |||| |||| | || ||||| |||| ||||||||||||||||||    
49683157 taatatattatgaggttttatgtcaaaatgtaagattctagtgttgcagcctctgtgcatgtactctaacccacgagc 49683080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 640 - 761
Target Start/End: Complemental strand, 49710811 - 49710689
Alignment:
640 gcaagtccaaagtctgaaatctttggacataaattt-tcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctcta 738  Q
    ||||||||||| |||||||| |||||||| |||||  |||||||  |  || ||||| ||||||||||||||||| || |||| |||| | || |||||     
49710811 gcaagtccaaaatctgaaatttttggacaaaaattaatcatctagtaatatattatgaggttttatgtcaaaatgcaagattctagtgttgcagcctctg 49710712  T
739 tgcaagtactctaacccacgagc 761  Q
    |||||||||||||  ||||||||    
49710711 tgcaagtactctagtccacgagc 49710689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 640 - 761
Target Start/End: Complemental strand, 49215473 - 49215352
Alignment:
640 gcaagtccaaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattcgagtggtacatcctctat 739  Q
    ||||||||||| |||||||| || ||||| ||||  ||| |||  |  || ||||| ||| ||||||||||||| || |||| |||| |||| ||||| |    
49215473 gcaagtccaaaatctgaaattttcggacaaaaatcatcagctagtaatatattatgaggtcttatgtcaaaatgcaagattctagtgttacagcctctgt 49215374  T
740 gcaagtactctaacccacgagc 761  Q
    ||||||||||||| ||||||||    
49215373 gcaagtactctaatccacgagc 49215352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 670 - 721
Target Start/End: Complemental strand, 49725197 - 49725146
Alignment:
670 aaattttcatctaaaagaatgttatgtggttttatgtcaaaatgtaaaattc 721  Q
    ||||| ||||| |||||||||||||| ||||||||||||||||| |||||||    
49725197 aaattctcatccaaaagaatgttatgaggttttatgtcaaaatgcaaaattc 49725146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 111 - 194
Target Start/End: Original strand, 52968533 - 52968616
Alignment:
111 tttggtccctgactttacacctcgctatcacaatggtcgttgactcgagataaaatacaaaatactcattggatgtgtacctcc 194  Q
    |||||||| | ||||| ||||||| | ||||||||||   |||||| ||||||||||||||||  ||| |||||||||||||||    
52968533 tttggtccttcactttgcacctcgttgtcacaatggtacatgactcaagataaaatacaaaatgatcactggatgtgtacctcc 52968616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 532
Target Start/End: Complemental strand, 10907039 - 10906998
Alignment:
491 tttccagcaacatcattccataactataaacatcagatttgt 532  Q
    |||| ||||||||||||||||||||||||||||| |||||||    
10907039 tttcaagcaacatcattccataactataaacatctgatttgt 10906998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 532
Target Start/End: Complemental strand, 10930922 - 10930881
Alignment:
491 tttccagcaacatcattccataactataaacatcagatttgt 532  Q
    |||| ||||||||||||||||||||||||||||| |||||||    
10930922 tttcaagcaacatcattccataactataaacatctgatttgt 10930881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 532
Target Start/End: Complemental strand, 10993126 - 10993085
Alignment:
491 tttccagcaacatcattccataactataaacatcagatttgt 532  Q
    |||| ||||||||||||||||||||||||||||| |||||||    
10993126 tttcaagcaacatcattccataactataaacatctgatttgt 10993085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 188
Target Start/End: Complemental strand, 17589751 - 17589674
Alignment:
111 tttggtccctgactttacacctcgctatcacaatggtcgttgactcgagataaaatacaaaatactcattggatgtgt 188  Q
    |||||||||||||||| |||||||||  ||||||||||  | ||||  |||||||||||||||| ||  |||||||||    
17589751 tttggtccctgactttgcacctcgctgacacaatggtctctaactccggataaaatacaaaatagtccctggatgtgt 17589674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 501 - 554
Target Start/End: Complemental strand, 49215612 - 49215559
Alignment:
501 catcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtct 554  Q
    |||||||||||||||||||||||| ||||| ||||| || || |||||||||||    
49215612 catcattccataactataaacatctgatttatgtgacaccccaccaaaatgtct 49215559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 491 - 531
Target Start/End: Complemental strand, 11041285 - 11041245
Alignment:
491 tttccagcaacatcattccataactataaacatcagatttg 531  Q
    |||| ||||||||||||||||||||||||||||| ||||||    
11041285 tttcaagcaacatcattccataactataaacatccgatttg 11041245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 467 - 550
Target Start/End: Complemental strand, 49725400 - 49725317
Alignment:
467 tgatgtttttcctccctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaaaat 550  Q
    |||||||||| ||||  |||||||||||||  | ||||||||||||||| |||||||| || || ||||| ||| | |||||||    
49725400 tgatgttttttctcctcccaaccatttccatgaccatcattccataactgtaaacatctgacttatgtgacactgcaccaaaat 49725317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 501 - 572
Target Start/End: Complemental strand, 49728788 - 49728717
Alignment:
501 catcattccataactataaacatcagatttgtgtgaaactcctccaaaatgtctattccacacttctggagc 572  Q
    |||||||||||||||||| |||||||||||||| || || || ||||||| ||||    |||||||||||||    
49728788 catcattccataactatatacatcagatttgtgagagacgccaccaaaatttctagagaacacttctggagc 49728717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 481 - 527
Target Start/End: Original strand, 9125105 - 9125151
Alignment:
481 cctccaaccatttccagcaacatcattccataactataaacatcaga 527  Q
    |||||||||| ||||||||||| ||| ||||||||||||| ||||||    
9125105 cctccaaccaattccagcaacaacatcccataactataaatatcaga 9125151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 532
Target Start/End: Complemental strand, 11026582 - 11026541
Alignment:
491 tttccagcaacatcattccataactataaacatcagatttgt 532  Q
    |||| |||||||||||||||||||| |||||||| |||||||    
11026582 tttcaagcaacatcattccataactgtaaacatctgatttgt 11026541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.000000000001; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 111 - 193
Target Start/End: Complemental strand, 17200786 - 17200704
Alignment:
111 tttggtccctgactttacacctcgctatcacaatggtcgttgactcgagataaaatacaaaatactcattggatgtgtacctc 193  Q
    ||||||| ||||| ||||| |||||| ||||||||||  || |||| ||||||||||||||||| ||  ||||||||||||||    
17200786 tttggtctctgaccttacatctcgctgtcacaatggttctttactcaagataaaatacaaaatagtctctggatgtgtacctc 17200704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 643 - 715
Target Start/End: Original strand, 31618457 - 31618529
Alignment:
643 agtccaaagtctgaaatctttggacataaattttcatctaaaagaatgttatgtggttttatgtcaaaatgta 715  Q
    |||||||| ||||| || |||||||| |||| |||||| ||||||||||| || |||||||| |||| |||||    
31618457 agtccaaaatctgagatttttggacaaaaatcttcatccaaaagaatgttttgaggttttatatcaagatgta 31618529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 481 - 548
Target Start/End: Original strand, 31614566 - 31614633
Alignment:
481 cctccaaccatttccagcaacatcattccataactataaacatcagatttgtgtgaaactcctccaaa 548  Q
    ||||||| |||||| || | || ||||||||||||||| |||||||||||||  |||||||| |||||    
31614566 cctccaatcatttcaagaatcaacattccataactatatacatcagatttgtaagaaactccgccaaa 31614633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108238 times since January 2019
Visitors: 1329