View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-19 (Length: 292)

Name: R108-tnk148-19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-19
R108-tnk148-19
[»] chr5 (1 HSPs)
chr5 (1-251)||(43407807-43408057)


Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 43407807 - 43408057
Alignment:
1 ctgagaaacaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggaggaggagatcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43407807 ctgagaaacaactttaattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggaggaggagatcaa 43407906  T
101 gcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgccacaatcacaataca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43407907 gcagatataattgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgccacaatcacaataca 43408006  T
201 tgtccaacaataataatattcctatgggaatgggagagggagatcacttca 251  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
43408007 tgtccaacaataataatattcctatgggaatgggagagggagatcacttca 43408057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110953 times since January 2019
Visitors: 1335