View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-2 (Length: 733)

Name: R108-tnk148-2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-2
R108-tnk148-2
[»] chr3 (3 HSPs)
chr3 (1-733)||(32084398-32085124)
chr3 (177-567)||(32086029-32086411)
chr3 (620-717)||(32085863-32085960)


Alignment Details
Target: chr3 (Bit Score: 646; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 646; E-Value: 0
Query Start/End: Original strand, 1 - 733
Target Start/End: Complemental strand, 32085124 - 32084398
Alignment:
1 acaatatgatgttgatgggaagcaaatatgataagacatggactggaagcaaagagtaaggtcagacacaagagaggccaaatgagatgcctaaaagaaa 100  Q
    |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
32085124 acaatatgatgttgatggaaagcaaatatgataagacatagactggaagcaaagagtaaggccagacacaagagaggccacatgagatgcctaaaagaaa 32085025  T
101 gatcatgactccaaagtactttagggattatgtcaaatcatctataagaaagccacacccttgcatttcctaatatattgatgtgattccagcattttca 200  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
32085024 gatcatgtctccaaagtactttagggattatgtcaaatcatctataagaaagccacacctttgcatttcctaatatattgatgtgattccagcattttca 32084925  T
201 aatcaagcaagacttaaaatctcattatctatttccttcttaggaggttatattagccctctagctatagcaaatttactcagttcctaatacttcggta 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
32084924 aatcaagcaagacttaaaatctcattatctatttccttcttaggaggttatattagccctctagctatagcaaatttactcagttcctaatactttggta 32084825  T
301 ttttcatcgagctaatctggagactactcgttcaaaatccaccgctaataaaatggaagaagccgttagcaaactcactaccaatcaatccacccttggt 400  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
32084824 ttttcatcgagctaatctggaaactactcgttcaaaatccaccgctaataaaatggaagaagccattagcaaactcactaccaatcaatccacccttggt 32084725  T
401 gaaacccaaactcttacagcctccaaaattgacgacattttccacaaatttgcctcccttgaaatacccattccctctgattctgcttcccttccaccac 500  Q
    ||||||||||||||||| ||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||    
32084724 gaaacccaaactcttacggcctccaaaattgacgacattctccacaaattagcgtcccttgaaatacccattccctctaattctgcttcccttccaccac 32084625  T
501 catccatcccttcctcctgccaaactacaatcacaatgtatgaagctcgatgtaccatgaaattttagcatcttgtagtgacctcgccattaggcttaga 600  Q
    |||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32084624 catccatcccttcctcctgccaaacta------caatgtatgaagctcgatgtaccatgaaattttagcatcttgtagtgacctcgccattaggcttaga 32084531  T
601 atttgttgtaacctgaatttgatagtgggctatgtaacatccctggtcatttgctctaactagtcttagcatctttagtccattaggctttgaacttgat 700  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32084530 atttgttgtaacctgaatttgatagtgggctatgtaacatccctggtcatttgctctaactagtcttagcatctttagtccattaggctttgaacttgat 32084431  T
701 gtgaacctgaattttatcacacgtaattacaat 733  Q
    ||||||||||||||||||| || ||||||||||    
32084430 gtgaacctgaattttatcagacataattacaat 32084398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 177 - 567
Target Start/End: Complemental strand, 32086411 - 32086029
Alignment:
177 attgatgtgattccagcattttcaaatcaagcaagacttaaaatctcattatctatttccttcttaggaggttatattagccctctagctatagcaaatt 276  Q
    ||||| || ||||||||||||| |||||||| |||| |  |||| ||||||||| ||||||||||||||||||    ||| |||  | |||| |||||||    
32086411 attgaagtaattccagcattttgaaatcaagaaagaatctaaatttcattatctttttccttcttaggaggttgc--tagtccttgaactattgcaaatt 32086314  T
277 tactcagttcctaatacttcggtattttcatcgagctaatctggagactactcgttcaaaatccaccgctaataaaatggaagaagccgttagcaaactc 376  Q
    ||| |||||||||| |||| ||| ||||||||| |||||||   | |||||  |||| ||| |||| ||  ||||||||||||||||| |||||||||||    
32086313 tacccagttcctaacactttggtgttttcatcgggctaatccaaaaactacatgttcgaaagccacagccgataaaatggaagaagccattagcaaactc 32086214  T
377 actaccaatcaatccacccttggtgaaacccaaactcttacagcctccaaaattgacgacattttccacaaatttgcctcccttgaaatacccattccct 476  Q
    | |||  ||||||  ||||||| ||||| |||||||||  | ||||||  |||||| |||||| ||||||| || ||||||||||| ||||||| || ||    
32086213 attactgatcaatttacccttgttgaaatccaaactctcccggcctccctaattgatgacattctccacaagttagcctcccttgacatacccactctct 32086114  T
477 ctgattctgcttc-ccttccaccaccatccatcccttcctcctgccaaactacaatcacaatgtatgaagctcgatgtaccatgaaatttta 567  Q
    ||| || |||||| |||||||||| || ||||||| ||||||| ||||||      ||||  | ||||||||||||||||||||||||||||    
32086113 ctg-ttatgcttctccttccaccatcaaccatcccctcctcctaccaaac------cacaccgcatgaagctcgatgtaccatgaaatttta 32086029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 620 - 717
Target Start/End: Complemental strand, 32085960 - 32085863
Alignment:
620 tgatagtgggctatgtaacatccctggtcatttgctctaactagtcttagcatctttagtccattaggctttgaacttgatgtgaacctgaattttat 717  Q
    |||||||||| | ||||||||||||| | ||| |||||| |||||||||| ||| |||||||||||||||  ||| ||| ||||||||||||||||||    
32085960 tgatagtgggttgtgtaacatccctgattattagctctagctagtcttagtatcgttagtccattaggctaagaatttgttgtgaacctgaattttat 32085863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110662 times since January 2019
Visitors: 1335