View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-20 (Length: 355)

Name: R108-tnk148-20
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-20
R108-tnk148-20
[»] chr7 (5 HSPs)
chr7 (1-284)||(35449149-35449432)
chr7 (108-284)||(35448918-35449094)
chr7 (318-355)||(35449428-35449465)
chr7 (6-257)||(35440925-35441176)
chr7 (88-194)||(35448780-35448886)


Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 35449432 - 35449149
Alignment:
1 ctattatgtgtctgtgcaacctgctgaaggtctgaacccaaaaaatatgcaacatgggtgggaatccaatttatcttatgagttgaataatggtggatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35449432 ctattatgtgtctgtgcaacctgctgaaggtctgaacccaaaaaatatgcaacatgggtgggaatccaatttatcttatgagttgaataatggtggatca 35449333  T
101 ttgtttggtatggttgacgtgtctgctcagggagattgttcaaacatgcattatagtcagaacacgaacatgggctttcaacaaggaattaatgagggaa 200  Q
    | ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35449332 tcgtttggtatggttgacgtgtctgctcaaggagattgttcaaccatgcattatagtcagaacacgaacatgggctttcaacaaggaattaatgagggaa 35449233  T
201 cagccatatcagaacctgaatatccaagttcttctactcgcatgtttggtactgatgaaaatgtcctggaggcctgcccaattg 284  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
35449232 tagccatatcagaacctgaatatccaagttcttctactcgcatgtttggtattgatgaaaatgtcctggaggcctgcccaattg 35449149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 108 - 284
Target Start/End: Complemental strand, 35449094 - 35448918
Alignment:
108 gtatggttgacgtgtctgctcagggagattgttcaaacatgcattatagtcagaacacgaacatgggctttcaacaaggaattaatgagggaacagccat 207  Q
    ||||||||||  |||||||||| ||||||| ||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||| ||| |  |||||    
35449094 gtatggttgatatgtctgctcatggagatttttcaagcatgcattatagtcagaactcgaacatgggttttcaacaaggaattaatggggggatggccat 35448995  T
208 atcagaacctgaatatccaagttcttctactcgcatgtttggtactgatgaaaatgtcctggaggcctgcccaattg 284  Q
    | |||||||||||||||||||||||||| || |||||||||||  ||||||||||||| ||||| ||||||||||||    
35448994 aacagaacctgaatatccaagttcttctcctagcatgtttggtgttgatgaaaatgtcatggagacctgcccaattg 35448918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 35449465 - 35449428
Alignment:
318 attttgttttacagcaactgagaatccagcatgctatt 355  Q
    ||||||||||||||||||||||||||||||||||||||    
35449465 attttgttttacagcaactgagaatccagcatgctatt 35449428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 35441176 - 35440925
Alignment:
6 atgtgtctgtgcaacctgctgaaggtctgaacccaaaaaatatgcaacatgggtgggaatccaatttatcttatgagttgaataatggtggatcattgtt 105  Q
    |||| ||||||||| || | |||||  ||||| |||||||| ||||||||||   || ||||||||| ||| ||  ||| |||||    |||||||  ||    
35441176 atgtttctgtgcaaactccagaaggcttgaactcaaaaaatctgcaacatggtgtggtatccaatttttctgatctgtttaataacaaaggatcatcatt 35441077  T
106 tggtatggttgacgtgtctgctcagggagattgttcaaacatgcattatagtcagaacacgaacatgggctttcaacaaggaattaatgagggaacagcc 205  Q
    ||||||||||||   ||||||||| ||||||  | ||| ||||  || || ||||||| | ||||||||  | ||||||||| |||||| |||||   ||    
35441076 tggtatggttgatacgtctgctcatggagatattccaagcatgacttttactcagaactcaaacatgggtatgcaacaaggagttaatgggggaatgacc 35440977  T
206 atatcagaacctgaatatccaagttcttctactcgcatgtttggtactgatg 257  Q
    |||||  |||||||  || |||||| |||| ||| |||||||||| ||||||    
35440976 atatccaaacctgataattcaagtttttctcctcacatgtttggtgctgatg 35440925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 88 - 194
Target Start/End: Complemental strand, 35448886 - 35448780
Alignment:
88 taatggtggatcattgtttggtatggttgacgtgtctgctcagggagattgttcaaacatgcattatagtcagaacacgaacatgggctttcaacaagga 187  Q
    ||||||||||||||  |||  |||||||||  |||||||||| ||||||  || || ||||||| ||||||||||| | |||||||  || || ||||||    
35448886 taatggtggatcatcatttcatatggttgagatgtctgctcacggagatattttaagcatgcatcatagtcagaactcaaacatggatttgcagcaagga 35448787  T
188 attaatg 194  Q
     ||||||    
35448786 gttaatg 35448780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111125 times since January 2019
Visitors: 1335