View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-21 (Length: 558)

Name: R108-tnk148-21
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-21
R108-tnk148-21
[»] chr3 (6 HSPs)
chr3 (1-410)||(43616479-43616888)
chr3 (75-354)||(43609928-43610206)
chr3 (407-558)||(43616332-43616483)
chr3 (87-354)||(43603531-43603798)
chr3 (407-481)||(43609787-43609861)
chr3 (408-489)||(43603379-43603461)


Alignment Details
Target: chr3 (Bit Score: 398; Significance: 0; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 1 - 410
Target Start/End: Original strand, 43616479 - 43616888
Alignment:
1 ggaatactgtaagacttatgtagctaatgttgatatgagttatgatgtggtgaattaattagagttgctcatggtatattgcagagtggagaaggtaaat 100  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43616479 ggaatactgtaagacttatatagctaatgttgatatgagttatgatgtggtgaattaattagagttgctcatggtatattgcagagtggagaaggtaaat 43616578  T
101 ttaaggacaaaatctggaatttcaaagataggaagtgtattattgtgcatggccggtgtagcgattctggcattttacaagggaccccaattacggatca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
43616579 ttaaggacaaaatctggaatttcaaagataggaagtgtattattgtgcatggccggtgtagcgattctggcattttacaagggaccccaattacggatcg 43616678  T
201 cgcgtcatcttctatctggatatcatcacaacaatcaagaacatgaatatcatgaatcatatgacaaaaaatggattttgggtgctttactcttgttcct 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43616679 cgcgtcatcttctatctggatatcatcacaacaatcaagaacatgaatatcatgaatcatatgacaaaaaatggattttgggtgctttactcttgttcct 43616778  T
301 aggcaccatcatgtggagcttgtggcttgtacttcaggtaccattaatttaatttcaatttgcggtataaggtctagaatgatgaaaacatttgtgttac 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
43616779 aggcaccatcatgtggagcttgtggcttgtacttcaggtaccattaatttaatttcaatttgtggtataaggtctagaatgatgaaaacatttgtgttac 43616878  T
401 attatgaatt 410  Q
    ||||||||||    
43616879 attatgaatt 43616888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 75 - 354
Target Start/End: Original strand, 43609928 - 43610206
Alignment:
75 tatattgcagagtggagaaggtaaatttaaggacaaaatctggaatttcaaagataggaagtgtattattgtgcatggccggtgtagcgattctggcatt 174  Q
    ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||    
43609928 tatattgtagagtggagaaggtaaatataaggacaaaatctggaatttcaaagatagggagtgttttattgtgcatggccggtgtagcgattctggcctt 43610027  T
175 ttacaagggaccccaattacggatcacgcgtcatcttctatctggatatcatcacaacaatcaagaacatgaatatcatgaatcatatgacaaaaaatgg 274  Q
    |||||||||||||||||| || ||  | ||||| || | ||||||||||||||||||| ||||| |||||||| ||  ||||||||||||||||||||||    
43610028 ttacaagggaccccaattgcgaattgcacgtcacctcccatctggatatcatcacaactatcaacaacatgaagatagtgaatcatatgacaaaaaatgg 43610127  T
275 attttgggtgctttactcttgttcctaggcaccatcatgtggagcttgtggcttgtacttcaggtaccattaatttaatt 354  Q
    ||||||||| |||||||||||||||||   ||||| |  ||||| |||||| |||||||||||||| || ||||||||||    
43610128 attttgggttctttactcttgttcctaactaccattacctggagtttgtggattgtacttcaggtagca-taatttaatt 43610206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 407 - 558
Target Start/End: Original strand, 43616332 - 43616483
Alignment:
407 aattgttaactgtcttccggcttcaacattcttctttgctgttatgctcaggtaaattttggaaaaccacattaattttcatctaagcttcattacagaa 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43616332 aattgttaactgtcttccggcttcaacattcttctttgctgttatgctcaggtaaattttggaaaaccacattaattttcatctaagcttcattacagaa 43616431  T
507 aagtaatataaaaattttattcgtaaagagaatgttgattacatgaaggaat 558  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
43616432 aagtaatataaaaattttattcgtaaagagaatgttgattacatgaaggaat 43616483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 87 - 354
Target Start/End: Original strand, 43603531 - 43603798
Alignment:
87 tggagaaggtaaatttaaggacaaaatctggaatttcaaagataggaagtgtattattgtgcatggccggtgtagcgattctggcattttacaagggacc 186  Q
    |||| ||||||||| ||||||||| ||||||||||||||||||||  |||||||||||||| ||||| ||||| ||||||||||||||||||||||||||    
43603531 tggaaaaggtaaatataaggacaatatctggaatttcaaagatagtgagtgtattattgtgtatggctggtgttgcgattctggcattttacaagggacc 43603630  T
187 ccaattacggatcacgcgtcatcttctatctggatatcatcacaacaatcaagaacatgaatatcatgaatcatatgacaaaaaatggattttgggtgct 286  Q
     ||| |||||||  |||| ||||| ||||||||||||||||||||| ||||| ||||| || ||  ||||||| |||| |||||||||||||||||| ||    
43603631 tcaaatacggattgcgcggcatctcctatctggatatcatcacaactatcaacaacataaagatagtgaatcacatgagaaaaaatggattttgggttct 43603730  T
287 ttactcttgttcctaggcaccatcatgtggagcttgtggcttgtacttcaggtaccattaatttaatt 354  Q
    || ||||||||||||| |||  |||||||||| |||||| ||||| |||||||||| || ||||||||    
43603731 ttcctcttgttcctagccacagtcatgtggagtttgtggattgtatttcaggtaccgtttatttaatt 43603798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 407 - 481
Target Start/End: Original strand, 43609787 - 43609861
Alignment:
407 aattgttaactgtcttccggcttcaacattcttctttgctgttatgctcaggtaaattttggaaaaccacattaa 481  Q
    ||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||    
43609787 aattgttaattgtcttccggcttcgacattcttctttgctgttctgctcaggtaaatttttgaaaaccacattaa 43609861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 408 - 489
Target Start/End: Original strand, 43603379 - 43603461
Alignment:
408 attgttaactgtcttccggcttcaacattcttctttgctgttatgctcaggtaaattttggaaaa-ccacattaattttcatc 489  Q
    |||||||| || ||||| ||||  |||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||    
43603379 attgttaattgccttcctgcttgtacattcttctttgctgttctgctcaggtaaattttggaaaatcaacattaattttcatc 43603461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175859 times since January 2019
Visitors: 1577