View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-22 (Length: 980)

Name: R108-tnk148-22
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-22
R108-tnk148-22
[»] chr4 (6 HSPs)
chr4 (20-708)||(51213384-51214067)
chr4 (818-980)||(51213166-51213328)
chr4 (818-977)||(51157193-51157352)
chr4 (818-977)||(51146071-51146230)
chr4 (845-977)||(29936847-29936979)
chr4 (834-977)||(51200007-51200150)
[»] chr3 (3 HSPs)
chr3 (20-422)||(49736043-49736448)
chr3 (818-980)||(49736719-49736881)
chr3 (509-629)||(49736460-49736580)
[»] chr1 (1 HSPs)
chr1 (934-977)||(38566397-38566440)


Alignment Details
Target: chr4 (Bit Score: 613; Significance: 0; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 613; E-Value: 0
Query Start/End: Original strand, 20 - 708
Target Start/End: Complemental strand, 51214067 - 51213384
Alignment:
20 gaattctcagctttatcaaaccatcctacttccatgtgaattattttctcgaagcacattaaccggattctttttatcaatttagaaccagctgcagcaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
51214067 gaattctcagctttatcaaaccatcctacttccatgtgaattattttctcgaagcacattaaccggattctttttatcaatttagaaccagctacagcaa 51213968  T
120 aagagtatgaccttaacggatgaaaaatgaaagatgccacgctaagggaaacaaatattaatgcccaaaattttgagtctttacgaagttcatctgcagg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51213967 aagagtatgaccttaacggatgaaaaatgaaagatgccacgctaagggaaacaaatattaatgcccaaaattttgagtctttacgaagttcatctgcagg 51213868  T
220 ctcaaaaaatgtatttatcattttggagatgagaaggcccagaataggtaacattgcaccatttactgttgctgccagagctcccatgagtaacaccggg 319  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51213867 ctcaaaaaatgtatttatcattttggagattagaaggcccagaataggtaacattgcaccatttactgttgctgccagagctcccatgagtaacaccggg 51213768  T
320 atttcaggcttgttaagataaacaaggagaaaaaatgggacatctcgagttttagttgatgatgcttttgctgaaggaacaacttcagaccctcctacta 419  Q
    ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51213767 atttcaggcttgttaagataagcaaggagaaaaaatggggcatctcgagttttagttgatgatgcttttgctgaaggaacaacttcagaccctcctacta 51213668  T
420 gtgtggctggcatagaatttgatgctatgaatgagttgtgactactgtttccaatccctgatgatccacggcttaaagacctttggcttgactctcttcc 519  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
51213667 gtgtgtctggcatagaatttgatgctatgaatgagttgtgactactgtttccaatccctgatgatccgcggcttaaagacctttggcttgactctcttcc 51213568  T
520 agagtctacaaagttttctagcttatccgagtcattatcaccaaactgttctgatgaatcctttttaatttcttgcaatctaatgagttgactataagct 619  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51213567 agagtctacaaagttttctagcttatccgagtcattatcaccaaactgttctgatgaatcctttttaatttcttgcaatctaatgagttgactataagct 51213468  T
620 ccatcaggattttttagtggagctcagcatgtggtaccctaataatcagttagtagaagaaataaagaatgctgcattgcgacaaactt 708  Q
    |||||||||| ||||||| ||||||||||||| ||| ||||||||||||||||||||||| || |||| ||||||||||||||| ||||    
51213467 ccatcaggat-ttttagt-gagctcagcatgt-gta-cctaataatcagttagtagaagatat-aagactgctgcattgcgacatactt 51213384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 163; E-Value: 2e-86
Query Start/End: Original strand, 818 - 980
Target Start/End: Complemental strand, 51213328 - 51213166
Alignment:
818 tacctttttctactacttttccttcgtgaataacagcaatgatatcagcgttccttattgtgcttaggcggtgagctacaatgatggttgttcggtttat 917  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51213328 tacctttttctactacttttccttcgtgaataacagcaatgatatcagcgttccttattgtgcttaggcggtgagctacaatgatggttgttcggtttat 51213229  T
918 cataattctgtccagggtctcttgtactactctttcagattctgcatcaagggcacttgttgc 980  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51213228 cataattctgtccagggtctcttgtactactctttcagattctgcatcaagggcacttgttgc 51213166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 818 - 977
Target Start/End: Complemental strand, 51157352 - 51157193
Alignment:
818 tacctttttctactacttttccttcgtgaataacagcaatgatatcagcgttccttattgtgcttaggcggtgagctacaatgatggttgttcggtttat 917  Q
    ||||| |||| |||| |||||| |  ||||| ||||||||| | ||| | || |||||||| |||| |||||||||||||| ||| ||||| ||||||||    
51157352 tacctctttcaactatttttccatgatgaatgacagcaatggtttcaacatttcttattgtacttaagcggtgagctacaacgatagttgtccggtttat 51157253  T
918 cataattctgtccagggtctcttgtactactctttcagattctgcatcaagggcacttgt 977  Q
    ||| ||||| ||||  | ||||||||| | ||| ||||||||||||||||||||||||||    
51157252 cattattctctccaatgcctcttgtacaattctctcagattctgcatcaagggcacttgt 51157193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 818 - 977
Target Start/End: Complemental strand, 51146230 - 51146071
Alignment:
818 tacctttttctactacttttccttcgtgaataacagcaatgatatcagcgttccttattgtgcttaggcggtgagctacaatgatggttgttcggtttat 917  Q
    ||||| |||| |||| ||||||||  ||||| ||||||||  ||||| | || ||||| ||||| | |||||| ||||||| ||| || || ||||||||    
51146230 tacctctttcaactatttttccttgatgaatgacagcaattgtatcaacatttcttatagtgctcaagcggtgtgctacaacgatagtcgtccggtttat 51146131  T
918 cataattctgtccagggtctcttgtactactctttcagattctgcatcaagggcacttgt 977  Q
    ||| ||||||| ||  | ||||||||| | ||| ||||||||||||||||||||||||||    
51146130 cattattctgttcaatgcctcttgtacaattctctcagattctgcatcaagggcacttgt 51146071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 845 - 977
Target Start/End: Original strand, 29936847 - 29936979
Alignment:
845 gaataacagcaatgatatcagcgttccttattgtgcttaggcggtgagctacaatgatggttgttcggtttatcataattctgtccagggtctcttgtac 944  Q
    |||| ||||||||| ||||| | || || ||||| |||| |||||||||||| | ||| || || ||||||||||| ||||| ||||  | |||||||||    
29936847 gaatgacagcaatggtatcaacatttctgattgtacttaagcggtgagctacgacgattgtcgtccggtttatcattattctttccaatgcctcttgtac 29936946  T
945 tactctttcagattctgcatcaagggcacttgt 977  Q
     | ||| ||||||||||||||||||||||||||    
29936947 aattctctcagattctgcatcaagggcacttgt 29936979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 834 - 977
Target Start/End: Complemental strand, 51200150 - 51200007
Alignment:
834 ttttccttcgtgaataacagcaatgatatcagcgttccttattgtgcttaggcggtgagctacaatgatggttgttcggtttatcataattctgtccagg 933  Q
    ||||||||  |||||||| |||||| ||||||| ||| ||||||| || |  |||||||||||||| |  ||||||||||||| ||| | ||| ||||      
51200150 ttttccttgatgaataacggcaatggtatcagcattctttattgtactcaaacggtgagctacaatcacagttgttcggtttaccattactctatccaat 51200051  T
934 gtctcttgtactactctttcagattctgcatcaagggcacttgt 977  Q
    | ||||||||| | ||| |||||||| |||||||| ||||||||    
51200050 gcctcttgtacaattctctcagattcagcatcaagcgcacttgt 51200007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 176; Significance: 3e-94; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 3e-94
Query Start/End: Original strand, 20 - 422
Target Start/End: Original strand, 49736043 - 49736448
Alignment:
20 gaattctcagctttatcaaaccatcctacttccatgtgaattattttctcgaagcacattaaccggattctttttatcaatttagaaccagctgcagcaa 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||  ||||||    
49736043 gaattctcagctttatcaaaccatcctacttccatgtgaattattttctcaaagcacattaaccggatcctttttatcaacttagaaccagcaacagcaa 49736142  T
120 aagagtatgaccttaacggatgaaaaatgaaagatgccacgctaagggaaacaaatattaatgcccaaaattttgagtctttacgaagttcatctgcagg 219  Q
    || |||| ||||||||||| ||||||| ||| || ||||| |||| | | ||||| |||||||||||||| ||    |||||||||||||||||||||||    
49736143 aaaagtaggaccttaacggctgaaaaacgaatgaagccacactaaagaacacaaacattaatgcccaaaaattcacatctttacgaagttcatctgcagg 49736242  T
220 ctcaaaaaatgtatttatcattttggagatgagaaggcccagaataggtaacattgcaccatttactgttgctgccagagctcccatgagtaacaccggg 319  Q
    |||||| |||||||||||||| |||||||  | ||| ||||||||||||  |||||| ||| |||||| |||||| ||||  || ||||||| | |||||    
49736243 ctcaaagaatgtatttatcatcttggagactaaaagtcccagaataggttgcattgctccaattactgctgctgctagagtcccaatgagtagcgccggg 49736342  T
320 atttcaggcttgttaagataaacaaggagaaaaaatgggacatctcgagttttagtt---gatgatgcttttgctgaaggaacaacttcagaccctccta 416  Q
    ||||||||||||||||||||| | ||  ||| ||||||||||||| |||| ||| ||     |||||||  ||||||||||| || ||||||| |||||     
49736343 atttcaggcttgttaagataagcgagacgaagaaatgggacatctggagtcttacttttatgtgatgctgctgctgaaggaagaaattcagacactcctt 49736442  T
417 ctagtg 422  Q
    ||||||    
49736443 ctagtg 49736448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 111; E-Value: 2e-55
Query Start/End: Original strand, 818 - 980
Target Start/End: Original strand, 49736719 - 49736881
Alignment:
818 tacctttttctactacttttccttcgtgaataacagcaatgatatcagcgttccttattgtgcttaggcggtgagctacaatgatggttgttcggtttat 917  Q
    |||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||  |||||||||||||    
49736719 tacctttttctactacttttccttggtgaataacggcaatgatatcagcattccttattgtgcttaggcggtgggctacaatgatcattgttcggtttat 49736818  T
918 cataattctgtccagggtctcttgtactactctttcagattctgcatcaagggcacttgttgc 980  Q
    ||||||||| || || ||||||||||| |||||||| || ||||| |||||||||||||||||    
49736819 cataattctttctagcgtctcttgtaccactctttccgactctgcgtcaagggcacttgttgc 49736881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 509 - 629
Target Start/End: Original strand, 49736460 - 49736580
Alignment:
509 gactctcttccagagtctacaaagttttctagcttatccgagtcattatcaccaaactgttctgatgaatcctttttaatttcttgcaatctaatgagtt 608  Q
    |||||||||||||| ||||||||  ||||||||||||| ||||||||| |||||  ||||||||||||||||||||||||||||||||  |||||||| |    
49736460 gactctcttccagattctacaaatgtttctagcttatctgagtcattagcaccatgctgttctgatgaatcctttttaatttcttgcagcctaatgagct 49736559  T
609 gactataagctccatcaggat 629  Q
    |||||||||||||||||||||    
49736560 gactataagctccatcaggat 49736580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 934 - 977
Target Start/End: Original strand, 38566397 - 38566440
Alignment:
934 gtctcttgtactactctttcagattctgcatcaagggcacttgt 977  Q
    |||||||||||||| |||||||||| ||||||||| ||||||||    
38566397 gtctcttgtactaccctttcagattttgcatcaagtgcacttgt 38566440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126335 times since January 2019
Visitors: 1390