View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-23 (Length: 742)

Name: R108-tnk148-23
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-23
R108-tnk148-23
[»] chr3 (3 HSPs)
chr3 (51-424)||(41550794-41551164)
chr3 (428-742)||(41551194-41551510)
chr3 (1-30)||(41551169-41551198)


Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 51 - 424
Target Start/End: Complemental strand, 41551164 - 41550794
Alignment:
51 aatttgagagtttttgacctttggtgaataataggaagcagtgtgagttcttcttgacactgattctattgttactgccttaaacaccaccattgcactg 150  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||    
41551164 aatttgagagtttttgacctttggtgaataataggaagcagtgtgagttcttcttgacactgattctattgttactgctttaaacac-accattgcactg 41551066  T
151 cacatttcggtcatggaagataacattgtttggtggttagaaaaaagatgcaatttatttcggtttgaagtgcacattattcttgcattgaaaatgacag 250  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||| |||||||| ||||||||||||||||||    
41551065 cacatttcggtcatggaagataacattgtttggaggttagaaaaa-gatgcaatttatt-cggtttgaagtgaacattatttttgcattgaaaatgacag 41550968  T
251 tgtttcggaccagctaaagtatagatggtagttggaatacaatttggctatccaaaattctgccgcaagtaaaaaattcaatttggcgaatttgttgtaa 350  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41550967 tgtttcggaccaactaaagtatagatggtagttggaatacaatttggctatccaaaattctgccgtaagtaaaaaattcaatttggcgaatttgttgtaa 41550868  T
351 ttgttttcctatgagtatgagactcattggtcgcggtgttcaatgtccaccaaattgtgcaatctgtgatagaa 424  Q
    || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
41550867 tttttttcctatgagtatgagactcattggtcgtggtgttcaatgtccaccaaattgtgcaatctgtgatagaa 41550794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 428 - 742
Target Start/End: Complemental strand, 41551510 - 41551194
Alignment:
428 aattctttttgatggggacataaatagggaacaatctagaatattcattagctcttgaaaacggctatgtacacaaaatcatggtagcatgggttttaaa 527  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41551510 aattctttttgatggggacataa-tagggaacaatctagaatattcattagctcttgaaaacggctatgtacacaaaatcatggtagcatgggttttaaa 41551412  T
528 aggttgaaggctttaactatacaatgcttggaaaacaagcctgc---aagttgttcacaaattctggtagcttaatcacttgcattggtcataacccaaa 624  Q
    || |||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||    
41551411 agtttgaaggctttaactatacaatgcttggaaaacaagcctgctgcaagttgttcacaaattctggtagcttaatcacttgcattggtcataacccaaa 41551312  T
625 ctacgttttgcgtagctaccgtagtatatggagtgcaaagtttgttgtcctaagagtgtaaaaatggtgtattggttcgcgtgaaaacataaaggtttag 724  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
41551311 ctacgttttgcgtagctaccgtagtatatggagtgcaaagtttgttgtcctaagagtgtaaaaatggtgtattggttcgtgtgaaaacataaaggtttag 41551212  T
725 accaaaaagggcgttatg 742  Q
    ||||||||||||||||||    
41551211 accaaaaagggcgttatg 41551194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 41551198 - 41551169
Alignment:
1 ttatgatggttctgtgttgatgaaccactt 30  Q
    ||||||||||||||||||||||||||||||    
41551198 ttatgatggttctgtgttgatgaaccactt 41551169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110730 times since January 2019
Visitors: 1335