View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-24 (Length: 884)

Name: R108-tnk148-24
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-24
R108-tnk148-24
[»] chr1 (118 HSPs)
chr1 (1-393)||(8139545-8139939)
chr1 (465-684)||(8141486-8141715)
chr1 (465-678)||(48669396-48669619)
chr1 (465-684)||(23767414-23767643)
chr1 (465-679)||(46825448-46825672)
chr1 (465-684)||(19315552-19315781)
chr1 (502-684)||(28425410-28425592)
chr1 (502-684)||(45670534-45670715)
chr1 (465-684)||(49094711-49094940)
chr1 (502-684)||(23228241-23228423)
chr1 (465-677)||(36157678-36157899)
chr1 (502-684)||(38473673-38473855)
chr1 (465-684)||(7651572-7651803)
chr1 (467-684)||(41982237-41982465)
chr1 (465-678)||(7553016-7553239)
chr1 (465-681)||(46095075-46095301)
chr1 (502-684)||(9878831-9879013)
chr1 (465-684)||(25988271-25988500)
chr1 (465-684)||(26069804-26070033)
chr1 (507-678)||(34970998-34971169)
chr1 (502-684)||(33673929-33674111)
chr1 (502-684)||(52146905-52147087)
chr1 (502-683)||(7608813-7608994)
chr1 (502-682)||(48319093-48319273)
chr1 (502-678)||(49814218-49814394)
chr1 (465-684)||(18892241-18892470)
chr1 (502-684)||(19274471-19274653)
chr1 (502-684)||(43396587-43396769)
chr1 (502-684)||(46051362-46051544)
chr1 (502-684)||(52349971-52350153)
chr1 (507-684)||(18782141-18782318)
chr1 (502-678)||(9974760-9974936)
chr1 (502-684)||(12142977-12143166)
chr1 (502-684)||(12964558-12964740)
chr1 (510-684)||(21964977-21965151)
chr1 (502-684)||(33325639-33325821)
chr1 (502-684)||(36781219-36781401)
chr1 (526-684)||(50099132-50099290)
chr1 (465-676)||(50689863-50690084)
chr1 (465-678)||(52067651-52067877)
chr1 (502-678)||(26549306-26549482)
chr1 (468-684)||(24204474-24204700)
chr1 (502-684)||(5400783-5400964)
chr1 (502-684)||(45350762-45350943)
chr1 (502-684)||(50533295-50533477)
chr1 (466-684)||(18917436-18917664)
chr1 (465-667)||(48802331-48802543)
chr1 (503-678)||(33714409-33714582)
chr1 (465-684)||(37216808-37217037)
chr1 (465-678)||(41105934-41106157)
chr1 (548-684)||(44979281-44979417)
chr1 (502-684)||(33194698-33194880)
chr1 (502-684)||(6711352-6711534)
chr1 (502-684)||(9962672-9962845)
chr1 (539-684)||(25800555-25800701)
chr1 (502-678)||(16705788-16705964)
chr1 (552-684)||(32373650-32373782)
chr1 (513-675)||(21929442-21929602)
chr1 (502-678)||(30281549-30281725)
chr1 (502-647)||(17983945-17984090)
chr1 (757-852)||(8141787-8141882)
chr1 (566-684)||(49973854-49973972)
chr1 (552-677)||(17989864-17989989)
chr1 (506-684)||(40721263-40721433)
chr1 (502-632)||(16506835-16506965)
chr1 (38-133)||(7499018-7499113)
chr1 (636-684)||(12143193-12143241)
chr1 (636-684)||(33325848-33325896)
chr1 (636-684)||(38473598-38473646)
chr1 (53-143)||(7502081-7502172)
chr1 (171-277)||(7501635-7501741)
chr1 (638-684)||(36781144-36781190)
chr1 (638-684)||(50690066-50690112)
chr1 (638-684)||(52067623-52067669)
chr1 (643-684)||(43396803-43396844)
chr1 (631-680)||(46825416-46825465)
chr1 (636-684)||(21965186-21965234)
chr1 (636-684)||(26549509-26549557)
chr1 (636-684)||(28425335-28425383)
chr1 (636-684)||(33674138-33674186)
chr1 (636-684)||(36157650-36157698)
chr1 (636-684)||(40721464-40721512)
chr1 (636-684)||(46051571-46051619)
chr1 (636-684)||(49094683-49094731)
chr1 (644-684)||(49814429-49814469)
chr1 (849-884)||(8139514-8139549)
chr1 (636-678)||(7608744-7608786)
chr1 (638-684)||(7651785-7651831)
chr1 (638-684)||(19315763-19315809)
chr1 (638-684)||(25800764-25800810)
chr1 (636-678)||(25988249-25988291)
chr1 (638-684)||(44978740-44978786)
chr1 (636-678)||(46095053-46095095)
chr1 (638-684)||(48802303-48802349)
chr1 (643-684)||(9962879-9962920)
chr1 (638-679)||(16705993-16706034)
chr1 (643-684)||(18917652-18917693)
chr1 (643-684)||(21929654-21929695)
chr1 (643-684)||(45350689-45350730)
chr1 (636-684)||(5400991-5401039)
chr1 (638-678)||(7552994-7553034)
chr1 (636-684)||(19274680-19274728)
chr1 (636-684)||(24204443-24204491)
chr1 (636-684)||(37217017-37217065)
chr1 (636-684)||(45670458-45670506)
chr1 (636-684)||(46825652-46825700)
chr1 (636-684)||(48669368-48669416)
chr1 (636-684)||(50533504-50533552)
chr1 (638-681)||(52147116-52147159)
chr1 (638-684)||(6711563-6711609)
chr1 (465-495)||(9878784-9878814)
chr1 (638-684)||(18782061-18782107)
chr1 (636-678)||(18892450-18892492)
chr1 (638-684)||(23767387-23767432)
chr1 (638-684)||(26070015-26070061)
chr1 (643-684)||(16505209-16505250)
chr1 (643-684)||(22351097-22351138)
chr1 (643-676)||(23228174-23228207)
[»] chr5 (77 HSPs)
chr5 (465-684)||(14717517-14717746)
chr5 (502-684)||(14952236-14952418)
chr5 (502-684)||(6740002-6740184)
chr5 (465-684)||(23128913-23129142)
chr5 (502-684)||(31710194-31710376)
chr5 (502-684)||(6331289-6331471)
chr5 (465-684)||(30297749-30297978)
chr5 (465-684)||(33760470-33760699)
chr5 (502-684)||(39824468-39824650)
chr5 (466-684)||(30863165-30863393)
chr5 (465-678)||(8215818-8216041)
chr5 (502-678)||(20079305-20079480)
chr5 (465-684)||(6600136-6600365)
chr5 (465-684)||(11000728-11000957)
chr5 (502-684)||(16752028-16752210)
chr5 (465-684)||(20408445-20408674)
chr5 (502-684)||(35342092-35342274)
chr5 (465-684)||(38964114-38964342)
chr5 (502-684)||(41282254-41282436)
chr5 (503-684)||(8689484-8689665)
chr5 (502-684)||(3352049-3352230)
chr5 (465-684)||(16095960-16096188)
chr5 (502-684)||(40074862-40075044)
chr5 (502-684)||(42993430-42993612)
chr5 (465-684)||(11692147-11692376)
chr5 (507-684)||(19398245-19398422)
chr5 (506-684)||(26035397-26035575)
chr5 (465-684)||(26593280-26593509)
chr5 (465-647)||(39002025-39002217)
chr5 (502-681)||(4015921-4016099)
chr5 (547-684)||(27509890-27510027)
chr5 (502-684)||(28078452-28078634)
chr5 (502-684)||(1052448-1052627)
chr5 (502-684)||(27116146-27116322)
chr5 (465-677)||(8694785-8695007)
chr5 (506-684)||(444866-445044)
chr5 (502-684)||(30208449-30208626)
chr5 (506-684)||(43166320-43166489)
chr5 (465-648)||(27457197-27457389)
chr5 (465-610)||(6251958-6252113)
chr5 (594-684)||(19661770-19661860)
chr5 (603-684)||(37923546-37923627)
chr5 (503-647)||(11935395-11935538)
chr5 (183-313)||(22210414-22210544)
chr5 (507-599)||(19659553-19659645)
chr5 (582-684)||(20517070-20517172)
chr5 (630-684)||(6251905-6251959)
chr5 (636-684)||(6252093-6252141)
chr5 (636-684)||(11000700-11000748)
chr5 (636-684)||(11935566-11935614)
chr5 (636-684)||(30297721-30297769)
chr5 (638-684)||(26593252-26593298)
chr5 (638-684)||(27457169-27457215)
chr5 (638-684)||(31710405-31710451)
chr5 (636-684)||(1052654-1052702)
chr5 (636-684)||(6600108-6600156)
chr5 (636-684)||(6739927-6739975)
chr5 (636-684)||(8694987-8695035)
chr5 (636-684)||(20079230-20079278)
chr5 (636-684)||(20408654-20408702)
chr5 (636-684)||(28078377-28078425)
chr5 (636-684)||(39824677-39824725)
chr5 (636-684)||(43166241-43166289)
chr5 (638-684)||(14952447-14952493)
chr5 (643-684)||(39401964-39402005)
chr5 (636-684)||(3351974-3352022)
chr5 (636-684)||(4015846-4015894)
chr5 (636-684)||(8216021-8216069)
chr5 (644-684)||(19659473-19659513)
chr5 (636-684)||(27116071-27116119)
chr5 (636-684)||(27510092-27510140)
chr5 (636-684)||(33760442-33760490)
chr5 (643-677)||(6332904-6332938)
chr5 (638-684)||(8689695-8689741)
chr5 (636-678)||(14717726-14717768)
chr5 (638-684)||(35342303-35342349)
chr5 (643-684)||(30208374-30208415)
[»] chr3 (85 HSPs)
chr3 (502-684)||(1448779-1448961)
chr3 (502-684)||(10618527-10618709)
chr3 (465-684)||(20760071-20760300)
chr3 (465-684)||(20813441-20813670)
chr3 (502-684)||(36315019-36315201)
chr3 (465-684)||(1016956-1017185)
chr3 (465-684)||(1687563-1687792)
chr3 (502-684)||(19664453-19664635)
chr3 (465-684)||(38446388-38446617)
chr3 (502-684)||(19268433-19268615)
chr3 (465-684)||(21564408-21564637)
chr3 (502-684)||(21890082-21890264)
chr3 (465-684)||(42016785-42017014)
chr3 (502-684)||(20086361-20086543)
chr3 (502-678)||(21656436-21656612)
chr3 (502-684)||(12748303-12748485)
chr3 (465-684)||(26455494-26455723)
chr3 (526-684)||(44152612-44152770)
chr3 (502-684)||(47329222-47329404)
chr3 (502-684)||(50977776-50977958)
chr3 (502-684)||(51080908-51081090)
chr3 (503-684)||(51562074-51562255)
chr3 (502-678)||(32650867-32651043)
chr3 (502-677)||(28699604-28699779)
chr3 (502-678)||(51475293-51475471)
chr3 (502-684)||(37247868-37248050)
chr3 (465-684)||(42107099-42107328)
chr3 (465-684)||(50287478-50287707)
chr3 (502-684)||(50364934-50365116)
chr3 (503-677)||(53195933-53196107)
chr3 (502-677)||(22851915-22852090)
chr3 (465-684)||(35346471-35346694)
chr3 (465-677)||(40922165-40922387)
chr3 (465-684)||(31122574-31122803)
chr3 (510-684)||(45380316-45380489)
chr3 (502-684)||(55164162-55164344)
chr3 (465-678)||(27070739-27070962)
chr3 (502-684)||(20913801-20913983)
chr3 (502-684)||(20921919-20922101)
chr3 (502-684)||(48651160-48651342)
chr3 (502-684)||(53926026-53926208)
chr3 (503-684)||(39069639-39069819)
chr3 (503-684)||(41250798-41250979)
chr3 (465-678)||(35608131-35608353)
chr3 (539-677)||(47473149-47473287)
chr3 (546-684)||(33473330-33473468)
chr3 (502-684)||(52821096-52821290)
chr3 (502-678)||(3697064-3697240)
chr3 (502-648)||(29677424-29677570)
chr3 (465-667)||(44798197-44798408)
chr3 (502-630)||(33151662-33151790)
chr3 (526-647)||(34019409-34019530)
chr3 (601-684)||(42641298-42641381)
chr3 (638-684)||(27070711-27070757)
chr3 (638-684)||(40922137-40922183)
chr3 (636-684)||(20086286-20086334)
chr3 (636-684)||(21656639-21656687)
chr3 (636-684)||(33151817-33151865)
chr3 (636-684)||(37248077-37248125)
chr3 (636-684)||(42107071-42107119)
chr3 (636-684)||(48651369-48651417)
chr3 (502-609)||(38924045-38924152)
chr3 (638-681)||(44152796-44152839)
chr3 (638-684)||(20760043-20760089)
chr3 (636-678)||(21890291-21890333)
chr3 (638-684)||(26455705-26455751)
chr3 (638-684)||(31122785-31122831)
chr3 (643-681)||(33473214-33473252)
chr3 (638-684)||(35346443-35346489)
chr3 (638-684)||(39069849-39069895)
chr3 (636-677)||(10618459-10618500)
chr3 (636-681)||(44798388-44798433)
chr3 (636-684)||(1687772-1687820)
chr3 (636-684)||(3697267-3697315)
chr3 (636-684)||(21564617-21564665)
chr3 (636-684)||(50287687-50287735)
chr3 (638-677)||(20813420-20813459)
chr3 (645-684)||(28775448-28775487)
chr3 (502-565)||(42641225-42641288)
chr3 (638-684)||(42016996-42017042)
chr3 (638-684)||(47329147-47329193)
chr3 (643-684)||(20913726-20913767)
chr3 (643-684)||(20921844-20921885)
chr3 (643-684)||(45380232-45380273)
chr3 (643-684)||(51562290-51562331)
[»] chr6 (53 HSPs)
chr6 (502-684)||(26393056-26393238)
chr6 (465-684)||(3408101-3408330)
chr6 (465-684)||(17942950-17943177)
chr6 (502-684)||(3258855-3259036)
chr6 (502-684)||(17428319-17428501)
chr6 (502-678)||(16193228-16193404)
chr6 (502-681)||(26230979-26231158)
chr6 (502-684)||(6503630-6503812)
chr6 (502-684)||(12626548-12626730)
chr6 (465-684)||(29050184-29050413)
chr6 (465-683)||(30378930-30379158)
chr6 (502-684)||(1915390-1915572)
chr6 (502-684)||(2707371-2707553)
chr6 (502-684)||(9382429-9382613)
chr6 (465-684)||(6785101-6785327)
chr6 (502-678)||(35223946-35224122)
chr6 (502-676)||(1077154-1077331)
chr6 (503-684)||(26936519-26936700)
chr6 (465-678)||(10256155-10256378)
chr6 (502-684)||(2390177-2390359)
chr6 (502-684)||(26196369-26196550)
chr6 (502-681)||(8178296-8178475)
chr6 (506-684)||(10931198-10931380)
chr6 (507-684)||(11133785-11133962)
chr6 (582-684)||(17515019-17515121)
chr6 (465-641)||(2598099-2598287)
chr6 (502-677)||(25820596-25820771)
chr6 (636-684)||(2707580-2707628)
chr6 (636-684)||(31376038-31376086)
chr6 (644-684)||(1077366-1077406)
chr6 (638-682)||(2598073-2598117)
chr6 (636-684)||(6503839-6503887)
chr6 (636-684)||(6785073-6785121)
chr6 (636-684)||(12612820-12612868)
chr6 (636-684)||(12626757-12626805)
chr6 (636-684)||(29050393-29050441)
chr6 (636-684)||(30379138-30379186)
chr6 (638-684)||(3408312-3408358)
chr6 (636-678)||(9382640-9382682)
chr6 (636-678)||(17428250-17428292)
chr6 (644-682)||(26392983-26393021)
chr6 (643-684)||(8178221-8178262)
chr6 (643-684)||(16193438-16193479)
chr6 (636-684)||(1915315-1915363)
chr6 (636-684)||(2390386-2390434)
chr6 (636-684)||(10256358-10256406)
chr6 (636-684)||(12612943-12612991)
chr6 (636-684)||(17943157-17943205)
chr6 (636-684)||(26230904-26230952)
chr6 (465-500)||(12612971-12613006)
chr6 (465-500)||(31376023-31376058)
chr6 (643-684)||(3258779-3258820)
chr6 (636-673)||(11133995-11134032)
[»] chr4 (93 HSPs)
chr4 (466-684)||(40988545-40988773)
chr4 (506-684)||(28160004-28160182)
chr4 (502-684)||(8882060-8882242)
chr4 (502-684)||(33174067-33174249)
chr4 (507-684)||(25734275-25734452)
chr4 (465-684)||(42273712-42273943)
chr4 (502-684)||(24458678-24458860)
chr4 (465-684)||(28264555-28264784)
chr4 (502-684)||(19168842-19169024)
chr4 (502-684)||(23135053-23135235)
chr4 (465-684)||(28812287-28812515)
chr4 (502-684)||(48707780-48707962)
chr4 (465-678)||(17847096-17847318)
chr4 (465-684)||(11795154-11795383)
chr4 (502-684)||(14564708-14564890)
chr4 (465-684)||(26017335-26017564)
chr4 (502-684)||(35929952-35930133)
chr4 (465-684)||(49118523-49118752)
chr4 (465-678)||(2055196-2055419)
chr4 (465-678)||(33807780-33808003)
chr4 (502-684)||(4545032-4545214)
chr4 (502-684)||(17993064-17993246)
chr4 (465-684)||(25730152-25730381)
chr4 (502-683)||(44490232-44490413)
chr4 (502-684)||(15984922-15985104)
chr4 (465-656)||(55517185-55517386)
chr4 (467-684)||(10588492-10588719)
chr4 (465-684)||(50276138-50276364)
chr4 (502-684)||(9339170-9339355)
chr4 (465-684)||(23552974-23553205)
chr4 (502-684)||(30467050-30467236)
chr4 (465-667)||(31591005-31591216)
chr4 (502-673)||(33693380-33693551)
chr4 (502-684)||(32118626-32118808)
chr4 (502-684)||(39995214-39995396)
chr4 (465-684)||(31208660-31208885)
chr4 (502-683)||(50542401-50542582)
chr4 (502-654)||(31973533-31973685)
chr4 (502-684)||(48149411-48149593)
chr4 (502-675)||(24623069-24623242)
chr4 (502-684)||(32317857-32318047)
chr4 (502-679)||(51371094-51371271)
chr4 (502-682)||(42549669-42549848)
chr4 (466-677)||(37381765-37381986)
chr4 (502-679)||(19496149-19496338)
chr4 (465-676)||(22298438-22298659)
chr4 (503-684)||(39699957-39700138)
chr4 (465-684)||(48551764-48551975)
chr4 (515-684)||(56555200-56555372)
chr4 (465-648)||(5227338-5227531)
chr4 (502-684)||(12196390-12196563)
chr4 (502-651)||(30141155-30141304)
chr4 (575-684)||(44490122-44490231)
chr4 (631-684)||(19496321-19496374)
chr4 (636-684)||(28812259-28812307)
chr4 (636-684)||(33807752-33807800)
chr4 (630-676)||(8433822-8433868)
chr4 (638-684)||(25730363-25730409)
chr4 (638-684)||(33173992-33174038)
chr4 (643-684)||(22298646-22298687)
chr4 (643-684)||(30466975-30467016)
chr4 (636-681)||(42273923-42273968)
chr4 (636-684)||(8881985-8882033)
chr4 (636-684)||(17847068-17847116)
chr4 (636-684)||(20534286-20534334)
chr4 (636-684)||(28264764-28264812)
chr4 (636-684)||(44490440-44490488)
chr4 (636-684)||(48149620-48149668)
chr4 (636-684)||(49118732-49118780)
chr4 (636-684)||(50276110-50276158)
chr4 (638-684)||(11795126-11795172)
chr4 (638-684)||(15985133-15985179)
chr4 (638-684)||(48551736-48551782)
chr4 (638-684)||(55517157-55517203)
chr4 (636-677)||(4544964-4545005)
chr4 (636-677)||(30141087-30141128)
chr4 (643-684)||(39995139-39995180)
chr4 (643-684)||(50542326-50542367)
chr4 (636-684)||(5227511-5227559)
chr4 (636-684)||(12196590-12196638)
chr4 (636-684)||(23134978-23135026)
chr4 (638-678)||(24458609-24458649)
chr4 (636-684)||(26017544-26017592)
chr4 (636-684)||(31591196-31591244)
chr4 (633-684)||(31617613-31617664)
chr4 (643-678)||(31973719-31973754)
chr4 (631-678)||(51371254-51371301)
chr4 (638-684)||(9339095-9339141)
chr4 (636-678)||(19496080-19496122)
chr4 (638-684)||(23553187-23553233)
chr4 (636-678)||(33452387-33452429)
chr4 (636-681)||(14564917-14564962)
chr4 (636-677)||(31208865-31208906)
[»] chr8 (67 HSPs)
chr8 (502-684)||(37933554-37933736)
chr8 (465-684)||(4649062-4649291)
chr8 (502-684)||(7434798-7434980)
chr8 (502-684)||(35884477-35884659)
chr8 (502-678)||(1293404-1293580)
chr8 (465-677)||(2533191-2533413)
chr8 (502-684)||(440752-440934)
chr8 (502-684)||(28707493-28707675)
chr8 (465-684)||(43806533-43806762)
chr8 (503-684)||(22684036-22684217)
chr8 (507-684)||(24430623-24430800)
chr8 (465-684)||(259890-260118)
chr8 (465-684)||(655803-656031)
chr8 (465-684)||(841538-841766)
chr8 (502-684)||(23935145-23935327)
chr8 (502-684)||(35443223-35443405)
chr8 (502-684)||(9056385-9056567)
chr8 (502-684)||(29485199-29485380)
chr8 (503-684)||(33651753-33651934)
chr8 (465-684)||(23972295-23972526)
chr8 (502-681)||(13797004-13797182)
chr8 (465-684)||(38208664-38208894)
chr8 (465-684)||(513220-513448)
chr8 (502-684)||(28496402-28496583)
chr8 (465-684)||(38107012-38107240)
chr8 (506-678)||(39513390-39513562)
chr8 (465-678)||(40301893-40302116)
chr8 (505-684)||(12010461-12010640)
chr8 (502-684)||(38633757-38633933)
chr8 (465-684)||(41536527-41536756)
chr8 (526-684)||(42988297-42988455)
chr8 (539-684)||(6016117-6016262)
chr8 (547-684)||(8137085-8137223)
chr8 (502-648)||(3875856-3876002)
chr8 (506-684)||(36218831-36219009)
chr8 (465-610)||(36400070-36400225)
chr8 (526-684)||(24193364-24193512)
chr8 (465-591)||(15847117-15847253)
chr8 (613-684)||(9884768-9884839)
chr8 (617-684)||(15847051-15847118)
chr8 (586-684)||(39295288-39295380)
chr8 (638-684)||(1293609-1293655)
chr8 (638-684)||(37933765-37933811)
chr8 (636-684)||(440961-441009)
chr8 (636-684)||(513428-513476)
chr8 (636-684)||(24193102-24193150)
chr8 (636-684)||(41536499-41536547)
chr8 (638-681)||(260100-260143)
chr8 (638-681)||(655778-655821)
chr8 (638-681)||(841513-841556)
chr8 (637-684)||(4649272-4649319)
chr8 (636-678)||(28496333-28496375)
chr8 (638-684)||(36400042-36400088)
chr8 (638-684)||(43806505-43806551)
chr8 (643-684)||(13797216-13797257)
chr8 (636-677)||(24430550-24430591)
chr8 (643-684)||(38633682-38633723)
chr8 (636-684)||(3876029-3876077)
chr8 (638-678)||(23972273-23972313)
chr8 (636-684)||(33651962-33652010)
chr8 (638-678)||(35884408-35884448)
chr8 (644-684)||(42988199-42988239)
chr8 (638-684)||(2533395-2533441)
chr8 (636-678)||(15847233-15847275)
chr8 (638-684)||(22683960-22684006)
chr8 (638-684)||(38107222-38107268)
chr8 (643-684)||(35443439-35443480)
[»] scaffold0184 (2 HSPs)
scaffold0184 (465-684)||(13007-13236)
scaffold0184 (638-684)||(13218-13264)
[»] scaffold0078 (2 HSPs)
scaffold0078 (465-684)||(59608-59837)
scaffold0078 (638-684)||(59580-59626)
[»] chr7 (81 HSPs)
chr7 (465-684)||(37393998-37394227)
chr7 (502-684)||(42979385-42979567)
chr7 (466-684)||(44544321-44544549)
chr7 (466-684)||(47219057-47219285)
chr7 (501-684)||(4923128-4923311)
chr7 (465-684)||(35600122-35600351)
chr7 (465-677)||(43752776-43752998)
chr7 (465-684)||(1469493-1469722)
chr7 (502-684)||(31684181-31684363)
chr7 (502-684)||(47271893-47272075)
chr7 (502-683)||(30798415-30798596)
chr7 (466-678)||(33884243-33884459)
chr7 (465-684)||(11476556-11476785)
chr7 (502-684)||(43968306-43968488)
chr7 (465-684)||(45723491-45723720)
chr7 (503-684)||(29248254-29248435)
chr7 (502-684)||(47281171-47281355)
chr7 (502-678)||(8162759-8162935)
chr7 (465-678)||(11050261-11050484)
chr7 (465-677)||(23842224-23842446)
chr7 (501-684)||(27364385-27364568)
chr7 (506-684)||(18353056-18353234)
chr7 (502-684)||(30876171-30876353)
chr7 (465-684)||(47294291-47294520)
chr7 (502-684)||(40851195-40851368)
chr7 (506-684)||(47119903-47120081)
chr7 (502-684)||(38427610-38427791)
chr7 (502-684)||(48628717-48628899)
chr7 (507-684)||(44800462-44800639)
chr7 (502-684)||(37354310-37354489)
chr7 (503-679)||(40520835-40521011)
chr7 (502-678)||(41139459-41139635)
chr7 (465-684)||(30971941-30972170)
chr7 (502-684)||(47579134-47579316)
chr7 (553-684)||(43025024-43025155)
chr7 (502-684)||(7335972-7336154)
chr7 (545-684)||(39033974-39034113)
chr7 (502-684)||(3797570-3797742)
chr7 (577-684)||(42888787-42888894)
chr7 (567-684)||(45233570-45233687)
chr7 (591-684)||(44550935-44551028)
chr7 (547-666)||(29739711-29739829)
chr7 (502-632)||(27774072-27774202)
chr7 (502-620)||(41113353-41113471)
chr7 (465-684)||(221208-221416)
chr7 (465-573)||(2960640-2960758)
chr7 (631-684)||(40520799-40520852)
chr7 (636-684)||(23842426-23842474)
chr7 (636-684)||(48628926-48628974)
chr7 (622-684)||(41107282-41107344)
chr7 (636-684)||(11476528-11476576)
chr7 (636-684)||(31684106-31684154)
chr7 (636-684)||(37393970-37394018)
chr7 (636-684)||(38427535-38427583)
chr7 (636-684)||(43752748-43752796)
chr7 (636-680)||(47281100-47281144)
chr7 (636-684)||(47294263-47294311)
chr7 (637-684)||(2960767-2960814)
chr7 (636-683)||(18353265-18353312)
chr7 (636-682)||(1469467-1469513)
chr7 (638-684)||(35600094-35600140)
chr7 (636-678)||(43968237-43968279)
chr7 (643-684)||(5106169-5106210)
chr7 (643-684)||(30876387-30876428)
chr7 (643-684)||(45723463-45723504)
chr7 (636-684)||(2960612-2960660)
chr7 (636-684)||(11050233-11050281)
chr7 (636-684)||(41113498-41113546)
chr7 (636-684)||(44544530-44544578)
chr7 (636-684)||(47120114-47120162)
chr7 (552-647)||(29739619-29739713)
chr7 (636-679)||(40851395-40851438)
chr7 (465-500)||(42888955-42888990)
chr7 (636-678)||(221396-221438)
chr7 (643-684)||(27364311-27364352)
chr7 (643-684)||(30798340-30798381)
chr7 (638-679)||(30971918-30971959)
chr7 (629-670)||(42888900-42888941)
chr7 (636-677)||(42979317-42979358)
chr7 (636-681)||(44800385-44800430)
chr7 (636-677)||(47272102-47272143)
[»] chr2 (71 HSPs)
chr2 (502-684)||(772022-772204)
chr2 (502-684)||(29737660-29737842)
chr2 (502-684)||(36210958-36211140)
chr2 (502-684)||(38750960-38751142)
chr2 (465-684)||(40854521-40854750)
chr2 (465-678)||(16246193-16246416)
chr2 (502-684)||(1106606-1106788)
chr2 (465-684)||(27328499-27328725)
chr2 (465-684)||(920934-921163)
chr2 (502-684)||(7378875-7379057)
chr2 (465-684)||(34253054-34253283)
chr2 (502-684)||(37654020-37654202)
chr2 (502-684)||(2455922-2456104)
chr2 (502-684)||(25087843-25088025)
chr2 (502-684)||(41500549-41500731)
chr2 (502-683)||(12759797-12759977)
chr2 (503-684)||(43249460-43249641)
chr2 (503-684)||(45124031-45124212)
chr2 (502-678)||(3430671-3430847)
chr2 (465-677)||(11949426-11949651)
chr2 (465-684)||(41178035-41178248)
chr2 (506-677)||(37732244-37732415)
chr2 (502-684)||(8396598-8396780)
chr2 (465-684)||(9276486-9276715)
chr2 (465-684)||(17484550-17484779)
chr2 (465-684)||(28650426-28650657)
chr2 (465-684)||(7297234-7297461)
chr2 (502-684)||(2056838-2057020)
chr2 (502-684)||(19180334-19180515)
chr2 (502-684)||(8899594-8899776)
chr2 (502-684)||(33865314-33865496)
chr2 (466-678)||(17134147-17134369)
chr2 (502-684)||(33107016-33107198)
chr2 (164-328)||(9130084-9130248)
chr2 (465-684)||(2094410-2094639)
chr2 (502-684)||(36444275-36444457)
chr2 (503-684)||(2315023-2315204)
chr2 (506-684)||(42629868-42630052)
chr2 (540-684)||(23672958-23673102)
chr2 (503-684)||(19916035-19916215)
chr2 (465-628)||(37838265-37838438)
chr2 (636-684)||(2094382-2094430)
chr2 (636-684)||(12759722-12759770)
chr2 (636-684)||(27328705-27328753)
chr2 (636-684)||(33106941-33106989)
chr2 (636-682)||(11949400-11949446)
chr2 (638-684)||(37732165-37732211)
chr2 (636-684)||(2456131-2456179)
chr2 (636-684)||(9276695-9276743)
chr2 (636-684)||(9331877-9331925)
chr2 (636-684)||(16246165-16246213)
chr2 (636-684)||(17484522-17484570)
chr2 (636-684)||(28650398-28650446)
chr2 (636-684)||(36444200-36444248)
chr2 (636-684)||(37838418-37838466)
chr2 (636-684)||(41500474-41500522)
chr2 (636-684)||(42630083-42630131)
chr2 (638-684)||(7297206-7297252)
chr2 (636-677)||(34253263-34253304)
chr2 (636-684)||(921143-921191)
chr2 (800-852)||(9130594-9130646)
chr2 (638-678)||(14630737-14630777)
chr2 (645-684)||(8899811-8899850)
chr2 (465-500)||(14630720-14630755)
chr2 (638-684)||(2057049-2057095)
chr2 (638-684)||(7379086-7379132)
chr2 (614-684)||(19511534-19511604)
chr2 (638-684)||(28216936-28216982)
chr2 (636-678)||(43249390-43249432)
chr2 (636-677)||(38751169-38751210)
chr2 (643-684)||(45124247-45124288)
[»] scaffold1986 (1 HSPs)
scaffold1986 (502-684)||(26-208)
[»] scaffold0005 (2 HSPs)
scaffold0005 (502-684)||(252485-252667)
scaffold0005 (636-681)||(252413-252458)
[»] scaffold0004 (2 HSPs)
scaffold0004 (465-684)||(218797-219027)
scaffold0004 (636-684)||(219007-219055)
[»] scaffold0542 (1 HSPs)
scaffold0542 (502-684)||(2020-2202)
[»] scaffold0693 (2 HSPs)
scaffold0693 (465-681)||(5027-5253)
scaffold0693 (638-677)||(5006-5045)
[»] scaffold0096 (1 HSPs)
scaffold0096 (502-684)||(47874-48056)
[»] scaffold0727 (2 HSPs)
scaffold0727 (465-684)||(5095-5326)
scaffold0727 (638-684)||(5308-5354)
[»] scaffold0122 (1 HSPs)
scaffold0122 (502-684)||(11277-11452)
[»] scaffold0392 (1 HSPs)
scaffold0392 (545-684)||(291-430)
[»] scaffold0117 (1 HSPs)
scaffold0117 (594-684)||(14561-14651)
[»] scaffold0130 (1 HSPs)
scaffold0130 (546-619)||(19758-19831)
[»] scaffold0717 (1 HSPs)
scaffold0717 (636-684)||(1938-1986)


Alignment Details
Target: chr1 (Bit Score: 356; Significance: 0; HSPs: 118)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 393
Target Start/End: Original strand, 8139545 - 8139939
Alignment:
1 gttttaactctgattgttctaacag--gtcgtcgctctctgggaacatcatggcaagaacaagtgcagaagcaagtgccgggcagggaaagtcacatcta 98  Q
    |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8139545 gttttaactctgattgttctaacagtggtcgtcgctctctgggaacatcatggcaagaacaagtgcagaagcaagtgccgggcagggaaagtcacatcta 8139644  T
99 gtgtcatggaaaataattggtaaactaacgaggtccttttctctttattgctgaaacaaatcaatatcagtgttgttaaatatccggtatatcggcgcta 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||    
8139645 gtgtcatggaaaataattggtaaactaacgaggtccttttctctttattgctgaaacaaatcaatatcagtgttattaaatatccggtgtatcggcgcta 8139744  T
199 tatcgctcttccgtgtcggattttagagtagacgatacaaaattcaatatgatttagcaacttcgatatttccgaaatatcagcgagattgcacaaatct 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8139745 tatcgctcttccgtgtcggattttagagtagacgatacaaaattcaatatgatttagcaacttcgatatttccgaaatatcagcgagattgcacaaatct 8139844  T
299 ggtatatcagtcatggcatgcatatcgaaaattgatgggttggtcaaatggttaggctcaatataataatatatgtcaaatggatctaaaagtcc 393  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||  ||||||||||||    
8139845 ggtatatcagtcatggcatgcatatcgaaaattgatgggttggttaaatggttagagtcaatataataatatatgtcaaatccatctaaaagtcc 8139939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 147; E-Value: 5e-77
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 8141486 - 8141715
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| |||||||||||||||||          |||| |||||||||||||||||| ||||||||||| |||||| ||||||||||    
8141486 gaatcgtttcaaacaagtcctattgtagatagcataatttgtaattgcttctttgaactcatctttagtaccaaatctgacttgtaacacccacttaaaa 8141585  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| |||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||| ||||||||||||    
8141586 ttagtcatctttttaggcatgacaaatggtggataatgttctttgttgctatcattcgaatcatcaccatcatcatctaaaaggacttgtttgaaacgat 8141685  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||||||||||||||||| |||||    
8141686 tcgaaaactaaaaggacttgtttgggactt 8141715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 137; E-Value: 4e-71
Query Start/End: Original strand, 465 - 678
Target Start/End: Original strand, 48669396 - 48669619
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||||||| ||| |||||||||||| ||||||||||||||||    
48669396 gaatcgtttcaaacaagtcctattgtagatagcatagttggtgattgcttccttgaactcatctttggtaccaaatctgactcctaacatccacttaaaa 48669495  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| ||||||   |||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||    
48669496 ttagtcatctttttaggcatgacaaataatggataatgttctttgttgctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 48669595  T
655 tcgaaaactaaaaggacttgtttg 678  Q
    || |||||||||||||||||||||    
48669596 tcaaaaactaaaaggacttgtttg 48669619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 135; E-Value: 7e-70
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 23767414 - 23767643
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||||||||           ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
23767414 gaatcgtttcaaacaagtcatattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 23767513  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| ||||||||||| |||||| |||||||||| ||||||||| |||||||||||||||||||| ||||||||||||    
23767514 ttagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctgaatcatcatcatcatcctctaaaaggacttgtttgaaacgat 23767613  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||||||||| ||||||||||    
23767614 tcaaaaactaaaaggacttatttgagactt 23767643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 134; E-Value: 3e-69
Query Start/End: Original strand, 465 - 679
Target Start/End: Complemental strand, 46825672 - 46825448
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| |||||||||||||||||          ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
46825672 gaatcgtttcaaacaagtcctattgtagatagcataattggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 46825573  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| ||||||||||| |||||| ||||||||||  ||||||||||||||||||||||||||||| ||||||||||||    
46825572 ttagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 46825473  T
655 tcgaaaactaaaaggacttgtttga 679  Q
    || ||||||||||||||||||||||    
46825472 tcaaaaactaaaaggacttgtttga 46825448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 465 - 684
Target Start/End: Complemental strand, 19315781 - 19315552
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||||||||           ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
19315781 gaatcgtttcaaacaagtcatattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctgcctcctaacacccacttaaaa 19315682  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| ||||||||||| |||||| |||||||||| |||||||||||||||||||||| || |||| ||||||||||||    
19315681 ttagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctgaatcatcaccatcatcctctagaaagacttgtttgaaacgat 19315582  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || ||||||||||| |||||||||||||||    
19315581 tcaaaaactaaaagaacttgtttgagactt 19315552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 28425410 - 28425592
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
28425410 cttccttgaactcatctttggtaccaaatctgactcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 28425509  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  ||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||    
28425510 gctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaatgacttgtttgagactt 28425592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 45670534 - 45670715
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| ||||||||| || ||||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |    
45670534 cttccttgaactcatctttggtaccaaatctgattcctaaca-ccacttaaaattagtcatctttttaggcatgacaaatggtggataatgttctttgtt 45670632  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| ||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||||||    
45670633 gctatcatctgaatcatcaccatcatcctctaaaatgacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 45670715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 49094711 - 49094940
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
49094711 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 49094810  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||||||||||||||  ||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||| ||||||||||||    
49094811 ttagtcatctttttaggcataacaaatggtggataatgttctttgttgctatcatcagaatcatcaccatcatcctctaaaagaacttgtttgaaacgat 49094910  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||| ||||||||||||||||    
49094911 tcaaaaactaaaatgacttgtttgagactt 49094940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 127; E-Value: 4e-65
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 23228241 - 23228423
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||||||| ||||||||| ||||||||||||||||||||||||| |||||| ||| ||||||| |||||| |    
23228241 cttccttgaactcatctttggtaccaaatctgactcctaacatccatttaaaattagtcatctttttaggcatgacaaatggtagataatgctctttgtt 23228340  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||| |||||    
23228341 gctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaatgacttgtttgggactt 23228423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 126; E-Value: 2e-64
Query Start/End: Original strand, 465 - 677
Target Start/End: Original strand, 36157678 - 36157899
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa---------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaat 555  Q
    ||||||||||||||||||| |||||||||||||||||         ||||||||||||||||||| ||| |||||||| ||| ||||| |||||||||||    
36157678 gaatcgtttcaaacaagtcctattgtagatagcataattggaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaat 36157777  T
556 tagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgatt 655  Q
    |||||||||||||||||| |||||| ||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||| |||||||| ||||    
36157778 tagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaatgatt 36157877  T
656 cgaaaactaaaaggacttgttt 677  Q
    | |||||||||| || ||||||    
36157878 caaaaactaaaatgatttgttt 36157899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 123; E-Value: 1e-62
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 38473673 - 38473855
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| ||||||||  || ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
38473673 cttccttgaactcatctttggtaccaaatctggttcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 38473772  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| ||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||| |||||    
38473773 gctatcatctgaatcatcaccatcatcctctaaaatgactagtttgaaacgattcaaaaactaaaaggacttgtttgggactt 38473855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 465 - 684
Target Start/End: Complemental strand, 7651803 - 7651572
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||||||||           |||| |||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
7651803 gaatcgtttcaaacaagtcatattgtagatagcatagttgataattgcttcattgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 7651704  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcat--caccatcatcctctaaaaggactggtttgaaacg 652  Q
    ||||||||||||||||||| |||||| ||||||||||| |||||| ||||||||||  ||||||  ||||||||||||||| ||||||| ||||||||||    
7651703 ttagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctaaatcatcacaccatcatcctctataaggacttgtttgaaacg 7651604  T
653 attcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||||||||||||||||    
7651603 attcaaaaactaaaaggacttgtttgagactt 7651572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 467 - 684
Target Start/End: Original strand, 41982237 - 41982465
Alignment:
467 atcgtttcaaacaagtcatattgtagatagcata----------acttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaatt 556  Q
    ||||||||||||||||||||||||||||| ||||          ||||| |||||||||||||| ||| |||||||||||| ||||| ||| ||||||||    
41982237 atcgtttcaaacaagtcatattgtagataacatagttgataattacttctttgaactcatctttggtaccaaatctgactcctaacacccatttaaaatt 41982336  T
557 agtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctct-aaaaggactggtttgaaacgatt 655  Q
    |||||| |||||||||| |||||| ||||||||||||| |||| |||||||||| ||||||||||||||||||||| |||| |||| |||||||||||||    
41982337 agtcatatttttaggcatgacaaatggtggataatgttttttgttgctatcatctgaatcatcaccatcatcctctaaaaatgacttgtttgaaacgatt 41982436  T
656 cgaaaactaaaaggacttgtttgagactt 684  Q
    | |||||||||||||||||||||||||||    
41982437 caaaaactaaaaggacttgtttgagactt 41982465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 121; E-Value: 2e-61
Query Start/End: Original strand, 465 - 678
Target Start/End: Original strand, 7553016 - 7553239
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||| ||||           ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
7553016 gaatcgtttcaaacaagtcatattgtagataacatagttggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 7553115  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||||||||||| || |||||| ||||||||||| |||||| |||||||||| ||||||||||||||||||||| ||| |||| ||||||||||||    
7553116 ttagtcatctttttagccatgacaaatggtggataatgctctttgttgctatcatctgaatcatcaccatcatcctctgaaaagacttgtttgaaacgat 7553215  T
655 tcgaaaactaaaaggacttgtttg 678  Q
    || |||||||||||||||||||||    
7553216 tcaaaaactaaaaggacttgtttg 7553239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 120; E-Value: 6e-61
Query Start/End: Original strand, 465 - 681
Target Start/End: Original strand, 46095075 - 46095301
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataact----------tccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||  |          |||||||||||||||||  ||||||||||| ||| ||||||||||||||||    
46095075 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgtttccttgaactcatctttgatatcaaatctgtctcctaacatccacttaaaa 46095174  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||||||||||  || |||||| ||||||||||| |||||| ||||||||||  | ||||||||||||||||||||||||||| ||||||||||||    
46095175 ttagtcatctttttaaacatgacaaatggtggataatgctctttgttgctatcatctaagtcatcaccatcatcctctaaaaggacttgtttgaaacgat 46095274  T
655 tcgaaaactaaaaggacttgtttgaga 681  Q
    || ||||||||||||||||||||||||    
46095275 tcaaaaactaaaaggacttgtttgaga 46095301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 9878831 - 9879013
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||||||| || ||| |  || ||||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |    
9878831 cttccttgaactcatctttagtaccatatcgggttcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgttctttgtt 9878930  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||| ||||| |||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||| |||||    
9878931 gctgtcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacgattcaaaaattaaaaggacttgtttgggactt 9879013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 25988271 - 25988500
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataact----------tccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||  |          ||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
25988271 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattggttccttgaactcatctttggtaccaaatctgcctcctaacacccacttaaaa 25988370  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| ||||||||||| | |||| ||||||||||  ||||||||| ||||| ||||||||||||| ||||||||||||    
25988371 ttagtcatctttttaggcatgacaaatggtggataatgctttttgttgctatcatctaaatcatcactatcattctctaaaaggacttgtttgaaacgat 25988470  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||||||||||||||||||||    
25988471 tcaaaaactaaaaggacttgtttgagactt 25988500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 465 - 684
Target Start/End: Complemental strand, 26070033 - 26069804
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataact----------tccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||| ||||  |          ||||||||||||| ||| |||||||||| | ||| ||||| ||||||||||    
26070033 gaatcgtttcaaacaagtcatattgtagatatcatagttggtaattgtttccttgaactcatttttggtatcaaatccggctcctaacacccacttaaaa 26069934  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| ||||||||||| |||||| || |||||||  ||||||||||||||||||||||||||||| ||||||||||||    
26069933 ttagtcatctttttaggcatgacaaatggtggataatgatctttgttgttatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 26069834  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||| ||||||||||||||||    
26069833 tcaaaaactaaaatgacttgtttgagactt 26069804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 116; E-Value: 2e-58
Query Start/End: Original strand, 507 - 678
Target Start/End: Complemental strand, 34971169 - 34970998
Alignment:
507 ttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctat 606  Q
    |||||||||| ||| |||||||||||||||| |||||  |||||||||||||||||||||||||||| | |||| |||||||||||||||||| ||||||    
34971169 ttgaactcatatttggtatcaaatctgactcctaacactcacttaaaattagtcatctttttaggcatggcaaatggtggataatgttctttgttgctat 34971070  T
607 catccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    |||| ||||||||  |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||    
34971069 catctgaatcatcgtcatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaaggacttgtttg 34970998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 115; E-Value: 6e-58
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 33674111 - 33673929
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| | |||| ||||||||||| |||||| |    
33674111 cttccttgaactcatctttcgtaccaaatctggctcctaacacccacttaaaattagtcatctttttaggcatggcaaatggtggataatgctctttgtt 33674012  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  ||||||||| ||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||| |||||    
33674011 gctatcatctaaatcatcacaatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaagaacttgtttgggactt 33673929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 115; E-Value: 6e-58
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 52147087 - 52146905
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||| |||||||||||||| ||||||||||||  || ||||| ||||||||||||| ||||||||||||||| |||||| ||||||||||| |||||| |    
52147087 cttcattgaactcatctttggtatcaaatctggttcctaacacccacttaaaattattcatctttttaggcatgacaaatggtggataatgctctttgtt 52146988  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| ||||||||||||||||||||||||| |||| |||||||||||||| |||||||||| |||||||||| |||||    
52146987 gctatcatctgaatcatcaccatcatcctctaaaatgactagtttgaaacgattcaaaaactaaaatgacttgtttgggactt 52146905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 502 - 683
Target Start/End: Original strand, 7608813 - 7608994
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||| |||||||||||||| ||| |||||||| ||| ||||| |||||||||||||||||| |||||||||| |||||| ||||||||||| |||||| |    
7608813 cttctttgaactcatcttttgtaccaaatctgcctcctaacacccacttaaaattagtcatgtttttaggcatgacaaatggtggataatgctctttgtt 7608912  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagact 683  Q
    ||||||||| ||||||||||||| ||||||||||| |||| |||||||||||||| ||||||||||||||||||||| ||||    
7608913 gctatcatctgaatcatcaccattatcctctaaaaagacttgtttgaaacgattcaaaaactaaaaggacttgtttgggact 7608994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 113; E-Value: 9e-57
Query Start/End: Original strand, 502 - 682
Target Start/End: Original strand, 48319093 - 48319273
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| |||  ||||||| ||| ||||| ||||||||||| |||||||||||||||||  ||||| |||||||||||||||||| |    
48319093 cttccttgaactcatctttggtactaaatctggctcctaacacccacttaaaatcagtcatctttttaggcattacaaatggtggataatgttctttgtt 48319192  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagac 682  Q
    ||||||||| ||||||||||||||||||||||||| |||| ||||||| | |||| |||||||||||||||||||||||||    
48319193 gctatcatctgaatcatcaccatcatcctctaaaatgacttgtttgaagcaattcaaaaactaaaaggacttgtttgagac 48319273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 113; E-Value: 9e-57
Query Start/End: Original strand, 502 - 678
Target Start/End: Complemental strand, 49814394 - 49814218
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||| | |||  |    
49814394 cttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctttttatt 49814295  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||  |||||||||    
49814294 gctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaataacttgtttg 49814218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 465 - 684
Target Start/End: Complemental strand, 18892470 - 18892241
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           |||| ||||||||||||||  || |||||||| ||  ||||| ||||| ||||    
18892470 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttctttgaactcatctttgataccaaatctggcttctaacacccactgaaaa 18892371  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||| ||||||| | |||||| ||||||||||| |||||| ||||||||||  ||||||||||||||||||||||||||||| ||||||||||||    
18892370 ttagtcatccttttaggaatgacaaatggtggataatgctctttgttgctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 18892271  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||||||||||||||||||||    
18892270 tcaaaaactaaaaggacttgtttgagactt 18892241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 19274653 - 19274471
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||| ||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| ||||||  |||||||||| |||||| |    
19274653 cttccttgaactcatttttggtaccaaatctggctcctaacacccacttaaaattagtcatctttttaggcatgacaaatagtggataatgctctttgtt 19274554  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  |||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| |||||    
19274553 gctatcatctaaatcatcatcatcatcctctaaaacgacttgtttgaaacgattcgaaaactaaaaggacttatttgggactt 19274471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 43396769 - 43396587
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||| |||   |||| | ||||||||| |||||| |    
43396769 cttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaattagtcatctttttaagcatagcaaatgatggataatgctctttgtt 43396670  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||| |||||||| |||| |||||||||||||| |||||||||||||||||||||||||||    
43396669 gctatcatctgaatcatcaccatcatactctaaaatgacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 43396587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 46051544 - 46051362
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| ||||||||  || ||||| |||||||||| |||||||||||||||||| | |||| ||||||||||| |||||| |    
46051544 cttccttgaactcatctttggtaccaaatctggttcctaacacccacttaaaactagtcatctttttaggcatggcaaatggtggataatgctctttgtt 46051445  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||| |||| |||||    
46051444 gctatcatctgaatcatcaccatcatcctctaaaaggactagtttgaaacgattcaaaaactaaaaggccttatttgggactt 46051362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 52349971 - 52350153
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||| |||||||||||  |||||||| || ||| ||||| ||||||||||||||||||||||||||||| ||||||  |||||||||| |||||| |    
52349971 cttccttaaactcatcttttctatcaaatttggctcttaacacccacttaaaattagtcatctttttaggcatgacaaatagtggataatgctctttgtt 52350070  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  ||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||    
52350071 gctatcatctaaatcatcaccatcattctctaaaaggacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 52350153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 110; E-Value: 6e-55
Query Start/End: Original strand, 507 - 684
Target Start/End: Original strand, 18782141 - 18782318
Alignment:
507 ttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctat 606  Q
    |||||||||||||| |||  |||||||  || || || ||||||||||||||||||||||||||||| | |||| |||||||||||||||||| ||||||    
18782141 ttgaactcatctttggtacaaaatctggttcatagcacccacttaaaattagtcatctttttaggcatggcaaatggtggataatgttctttgttgctat 18782240  T
607 catccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||| ||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||    
18782241 catctgaatcatcaccaccattctctaaaaggacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 18782318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 109; E-Value: 2e-54
Query Start/End: Original strand, 502 - 678
Target Start/End: Complemental strand, 9974936 - 9974760
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||| ||| |||  |||| || ||||||||| ||||||||||||||||||||||||||||| |  ||| |||||||||||||||||| |    
9974936 cttccttgaactcatttttggtactaaatatggctcgtaacacccacttaaaattagtcatctttttaggcatggtaaatggtggataatgttctttgtt 9974837  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    ||||||||| |||||||||| ||||||||||||||||||| |||||||||||||  |||||||||||||||||||||    
9974836 gctatcatctgaatcatcacaatcatcctctaaaaggacttgtttgaaacgatttaaaaactaaaaggacttgtttg 9974760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 108; E-Value: 9e-54
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 12143166 - 12142977
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
12143166 cttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 12143067  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactgg-------tttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  ||||||||||||||||||||||||||||| |       ||||||||||||| ||||||||||||||||||||| |||||    
12143066 gctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaatttgaaacgattcaaaaactaaaaggacttgtttgggactt 12142977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 12964740 - 12964558
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| | || |||||| |||||| |    
12964740 cttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaattagtcatctttttaggcatgacaaatgttgtataatgctctttgtt 12964641  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  ||||||||||||||||||||||||| ||| ||||||||| |||| |||| |||||| |||||||||||||||    
12964640 gctatcatctaaatcatcaccatcatcctctaaaagaacttgtttgaaacaattcaaaaattaaaagaacttgtttgagactt 12964558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 510 - 684
Target Start/End: Complemental strand, 21965151 - 21964977
Alignment:
510 aactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcat 609  Q
    ||||||||||| ||| |||||||||||| | ||| ||||||||||||||||||||||||||||| | |||| |||| ||||||||||||| |||||||||    
21965151 aactcatctttggtaccaaatctgactccttacacccacttaaaattagtcatctttttaggcatggcaaatggtgtataatgttctttgttgctatcat 21965052  T
610 ccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| ||||||||||| |||||||| ||||  ||||||||||||||||||||||||||| ||| |||||||||    
21965051 ccgaattatcaccatcattctctaaaaagacttatttgaaacgattcgaaaactaaaaggatttgattgagactt 21964977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 33325821 - 33325639
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||| ||||||||||| |||||||||||| ||  ||| | ||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
33325821 cttccttaaactcatctttggtatcaaatctggcttctaagacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 33325722  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||  |||||  |||||||||||||||||||||||| || | |||||||||||||| |||||||||||||||||||||||||||    
33325721 gcactcatctaaatcatcaccatcatcctctaaaatgatttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 33325639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 36781219 - 36781401
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| ||||||||  || ||||| |||||||||||||||| ||||||| |||| | |||| ||||||||||| | |||| |    
36781219 cttccttgaactcatctttggtaccaaatctggttcctaacacccacttaaaattagtcgtctttttgggcatggcaaatggtggataatgctttttgtt 36781318  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||| |||||    
36781319 gctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacgattcaaaaattaaaaggacttgtttgggactt 36781401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 526 - 684
Target Start/End: Complemental strand, 50099290 - 50099132
Alignment:
526 caaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatc 625  Q
    ||||| |||||  ||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |||||||||| ||||||||||||||    
50099290 caaatatgacttttaacatccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctgaatcatcaccatc 50099191  T
626 atcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||||| |||| |||||||||||||  |||||||||||| ||||||||||||||    
50099190 atcctctaaaatgacttgtttgaaacgatttaaaaactaaaaggtcttgtttgagactt 50099132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 465 - 676
Target Start/End: Complemental strand, 50690084 - 50689863
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||| ||||           |||| |||||||||||||| ||| ||||| || ||| ||||| ||||||||||    
50690084 gaatcgtttcaaacaagtcatattgtagataacatagttggtaattgcttcattgaactcatctttggtaccaaatttggctcctaacacccacttaaaa 50689985  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||||||||||||||   |||| | ||||||||| |||||| ||||||||||  ||||||||||||||||||||||||||||| ||||||||||||    
50689984 ttagtcatctttttaggcatagcaaatgatggataatgctctttgttgctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 50689885  T
655 tcgaaaactaaaaggacttgtt 676  Q
    || |||||||||||||||||||    
50689884 tcaaaaactaaaaggacttgtt 50689863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 465 - 678
Target Start/End: Original strand, 52067651 - 52067877
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||| |||||||| ||||||          |||||||||||||||| || ||| |||||||||||| ||||| ||||||||||    
52067651 gaatcgtttcaaacaagtcatgttgtagatggcataatttgtaattgcttccttgaactcatcgttggtaccaaatctgactcctaacacccacttaaaa 52067750  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccga---atcatcaccatcatcctctaaaaggactggtttgaaac 651  Q
    ||| ||||||||||||| | |||||| ||||||||||| |||||| |||||||||| ||   ||||||| ||||||||||||||| |||| |||||||||    
52067751 ttattcatctttttagggatgacaaatggtggataatgctctttgttgctatcatctgaatcatcatcatcatcatcctctaaaatgacttgtttgaaac 52067850  T
652 gattcgaaaactaaaaggacttgtttg 678  Q
    ||||| |||||||||||||||||||||    
52067851 gattcaaaaactaaaaggacttgtttg 52067877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 105; E-Value: 6e-52
Query Start/End: Original strand, 502 - 678
Target Start/End: Complemental strand, 26549482 - 26549306
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||||||||||||||||||  || ||||||||  || ||||| ||||||||||||||||||||||||||||| || ||| ||||||||||| |||||| |    
26549482 cttccttgaactcatctttgataccaaatctggttcctaacacccacttaaaattagtcatctttttaggcatgataaatggtggataatgctctttgtt 26549383  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    |||||||||  ||||||||||||||| ||||||||| ||| |||||||||||||| |||||||||||||||||||||    
26549382 gctatcatctaaatcatcaccatcattctctaaaagaacttgtttgaaacgattcaaaaactaaaaggacttgtttg 26549306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 468 - 684
Target Start/End: Original strand, 24204474 - 24204700
Alignment:
468 tcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaatta 557  Q
    |||||||||||||||| ||||||||||||||||           ||||||||||||| ||||| ||| |||||||| ||| ||| | ||||||||||| |    
24204474 tcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcgtctttggtaccaaatctggctcctaatacccacttaaaatga 24204573  T
558 gtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcg 657  Q
    |||||||||||||||| | |||| | ||||||||| |||||  ||||||||||  ||||||||||||||||||||||||||||| ||||||||| ||||     
24204574 gtcatctttttaggcatggcaaatgatggataatgctctttattgctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacaattca 24204673  T
658 aaaactaaaaggacttgtttgagactt 684  Q
    |||||||||||||||||||||||||||    
24204674 aaaactaaaaggacttgtttgagactt 24204700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 103; E-Value: 9e-51
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 5400964 - 5400783
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| ||||||||  |  ||||||||||||||||||||||||||||||||||| | |||| ||||||||||  | |||| |    
5400964 cttccttgaactcatctttggtaccaaatctggtttctaacatccacttaaaattagtcatctttttaggcatg-caaatggtggataatactatttgtt 5400866  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||| |||||||||||||||||||||||||  ||||||||||||| |||| ||||||||||||||||||||||    
5400865 gctatcatctgaataatcaccatcatcctctaaaaggacttctttgaaacgattcaaaaattaaaaggacttgtttgagactt 5400783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 103; E-Value: 9e-51
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 45350762 - 45350943
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||| ||||||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||| |||| |    
45350762 cttccttgatctcatctttggtaccaaatctggctcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgttttttgtt 45350861  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  ||| |||||||||||||||| |||||||| |||||||||||||| ||||||||||  ||||||||| |||||    
45350862 gctatcatctaaattatcaccatcatcctct-aaaggacttgtttgaaacgattcaaaaactaaaaaaacttgtttgggactt 45350943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 103; E-Value: 9e-51
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 50533477 - 50533295
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||| |||||||||||||| ||| | |||||| ||| ||||| ||||||||||||||||||||||||||||| | ||||   ||||||||| |||||| |    
50533477 cttcattgaactcatctttggtaccgaatctggctcctaacacccacttaaaattagtcatctttttaggcatgtcaaattttggataatgctctttgtt 50533378  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| ||||||||||||||||||| ||||| ||||  ||||||||||||| |||||||||||||||||||||||||||    
50533377 gctatcatctgaatcatcaccatcatcctttaaaatgacttttttgaaacgattcaaaaactaaaaggacttgtttgagactt 50533295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 466 - 684
Target Start/End: Complemental strand, 18917664 - 18917436
Alignment:
466 aatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaat 555  Q
    ||||||||||||||| |||||||||||||||||||           |||||||||| | |||||| ||| ||||| |||||| ||||| |||||||||||    
18917664 aatcgtttcaaacaaatcatattgtagatagcatatttaataattgcttccttgaatttatctttggtaccaaatatgactcctaacacccacttaaaat 18917565  T
556 tagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgatt 655  Q
    |||||||||||||||||| | |||| ||||||||||  |||||| | |||||||| |||||||||  |||||||||||||| |||| |||||||||||||    
18917564 tagtcatctttttaggcatggcaaatggtggataattctctttgttactatcatctgaatcatcattatcatcctctaaaaagacttgtttgaaacgatt 18917465  T
656 cgaaaactaaaaggacttgtttgagactt 684  Q
    | |||||||||| ||||||||||||||||    
18917464 caaaaactaaaatgacttgtttgagactt 18917436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 465 - 667
Target Start/End: Original strand, 48802331 - 48802543
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           |||| |||||||||||||| ||||||||| || ||| ||||| | ||||||||    
48802331 gaatcgtttcaaacaagtcttattgtagatagcatagttggtaattgcttcattgaactcatctttggtatcaaatatggctcctaacacctacttaaaa 48802430  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||||||| |||||| || ||| ||||||||||| |||||| ||||||||||  ||||||||||||||||||||||||||||| ||||||||||||    
48802431 ttagtcatctttgtaggcatgataaatggtggataatgctctttgttgctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 48802530  T
655 tcgaaaactaaaa 667  Q
    || ||||||||||    
48802531 tcaaaaactaaaa 48802543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 503 - 678
Target Start/End: Original strand, 33714409 - 33714582
Alignment:
503 ttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtg 602  Q
    ||||||||||||||||||  || |||||||||||| ||||| ||||||| | ||||||||||||||||||| |||||| |||||||||| ||||||| ||    
33714409 ttccttgaactcatctttgataccaaatctgactcctaaca-ccacttaca-ttagtcatctttttaggcatgacaaatggtggataatattctttgttg 33714506  T
603 ctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    |||||||| ||||||||||||| |||||||||||| ||| |||||||||||||| |||||||| ||||||||||||    
33714507 ctatcatctgaatcatcaccattatcctctaaaagaacttgtttgaaacgattcaaaaactaagaggacttgtttg 33714582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 465 - 684
Target Start/End: Complemental strand, 37217037 - 37216808
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataact----------tccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||  |          ||||||||||||||||| ||| ||| |||  ||| ||||| ||||||||||    
37217037 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgtttccttgaactcatctttggtaccaactctagctcataacacccacttaaaa 37216938  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||||||||||| || | |||| |||||||||||||||||| || |||||||  |||||||||||||||||| |||||| ||| ||||||||| ||    
37216937 ttagtcatctttttagacatggcaaatggtggataatgttctttgttggtatcatctaaatcatcaccatcatcctttaaaagcacttgtttgaaacaat 37216838  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||| ||||||||||||||||    
37216837 tcaaaaactaaaatgacttgtttgagactt 37216808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 465 - 678
Target Start/End: Complemental strand, 41106157 - 41105934
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||||||| ||| |||||||||||| ||||| ||||||||||    
41106157 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctgactcctaacacccacttaaaa 41106058  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| ||||||||||| |||||| |||||| ||   |||||||||||||||||| ||||| ||   |||||||||| |    
41106057 ttagtcatctttttaggcatgacaaatggtggataatgctctttgttgctattatttaaatcatcaccatcatcctataaaatgatctgtttgaaacggt 41105958  T
655 tcgaaaactaaaaggacttgtttg 678  Q
    || |||| ||||||||||| ||||    
41105957 tcaaaaattaaaaggacttttttg 41105934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 548 - 684
Target Start/End: Original strand, 44979281 - 44979417
Alignment:
548 cttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttg 647  Q
    |||||||||||||||||||||||||| |||||| ||||||||||| |||||| |||||||||| ||||||||||||||||||||||||| |||| |||||    
44979281 cttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctgaatcatcaccatcatcctctaaaatgacttgtttg 44979380  T
648 aaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  |||||||||||||||||||| |||||    
44979381 aaacgattcataaactaaaaggacttgtttgggactt 44979417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 33194698 - 33194880
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||| ||||||||||||||||| | | || ||||| ||||| |||||| |    
33194698 cttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaatcagtcatctttttaggcatggcgaatggtggttaatgctctttgtt 33194797  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||||||||||||||||| ||| |||||||||| |||| | ||| || ||||||| |||||    
33194798 gctatcatctgaatcatcaccatcatcctctaaaaggacttgttcgaaacgattcaaaaagtcaaatgatttgtttgggactt 33194880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 6711534 - 6711352
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||  ||||| |||||||||||||| ||||||||||  || |  ||| ||||||||||| |||||| |    
6711534 cttccttgaactcatctttggtaccaaatctggcttctaacacccacttaaaattagccatctttttacacatggtaaatggtggataatgctctttgtt 6711435  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||  ||||||||||||||||||| ||||| |||| |||||||||||||| |||||||||| || |||||||||||||    
6711434 gctatcatttgaatcatcaccatcatcctttaaaatgacttgtttgaaacgattcaaaaactaaaatgatttgtttgagactt 6711352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 9962845 - 9962672
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||   || ||||| ||||||||||||||||||||||||||||| || ||| |||||||||||||||||| |    
9962845 cttccttgaactcatctttggtaccaaatctagttcctaacacccacttaaaattagtcatctttttaggcatgataaatggtggataatgttctttgtt 9962746  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||         ||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||| ||||||||||||    
9962745 gct---------atcatcaccatcatcctctaaaaagactagtttgaaacgattcaaaaactaaaaggacgtgtttgagactt 9962672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 539 - 684
Target Start/End: Complemental strand, 25800701 - 25800555
Alignment:
539 taacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaagg 638  Q
    ||||| ||||||||||||||||||||||||||||| || ||| |||||||||||||||||  |||| |||||  ||||||||||||||||||||||||||    
25800701 taacacccacttaaaattagtcatctttttaggcatgataaatggtggataatgttcttttttgctttcatcttaatcatcaccatcatcctctaaaagg 25800602  T
639 actggttt-gaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||| ||||  ||||||||| |||||||||||||||||||||||||||    
25800601 acttgtttaaaaacgattcaaaaactaaaaggacttgtttgagactt 25800555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 502 - 678
Target Start/End: Complemental strand, 16705964 - 16705788
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| | | ||| | ||||||||||||||||||||||||||||| |  ||| ||||||||||| |||||| |    
16705964 cttccttgaactcatctttggtaccaaatctggcgcctaaaacccacttaaaattagtcatctttttaggcatggaaaatggtggataatgctctttgtt 16705865  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
     |||||| | ||||||||  ||| |||||||||||||||| |||||||||||||| |||||| ||||||||||||||    
16705864 tctatcacctgaatcatcgtcattatcctctaaaaggacttgtttgaaacgattcaaaaacttaaaggacttgtttg 16705788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 552 - 684
Target Start/End: Original strand, 32373650 - 32373782
Alignment:
552 aaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaac 651  Q
    |||||||||||||||||||||| |||||| ||||||||||| |||||| | |||||||| |||| ||||||||||||||||||||||||| ||||||||     
32373650 aaattagtcatctttttaggcatgacaaatggtggataatgctctttgttactatcatctgaatgatcaccatcatcctctaaaaggacttgtttgaaaa 32373749  T
652 gattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||| |||||||||| ||||||||||||||||    
32373750 gattcaaaaactaaaatgacttgtttgagactt 32373782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 88; E-Value: 8e-42
Query Start/End: Original strand, 513 - 675
Target Start/End: Complemental strand, 21929602 - 21929442
Alignment:
513 tcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccg 612  Q
    |||||||| ||| |||||||| ||| ||| | ||||||||||||||||||||||||||  | | |||| |||||||||| ||||||| |||||||||| |    
21929602 tcatctttggtaccaaatctggctcctaaaacccacttaaaattagtcatctttttag--atggcaaatggtggataatcttctttgttgctatcatctg 21929505  T
613 aatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgt 675  Q
    ||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||| ||||    
21929504 aatcatcaccatcatcctctaaaagaacttgtttgaaacgattcaaaaactaaaaggatttgt 21929442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 502 - 678
Target Start/End: Complemental strand, 30281725 - 30281549
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||||||| ||||| |||||||| |  ||| ||||||||||||| |  ||| ||||||||||| |||||| |    
30281725 cttccttgaactcatctttggtaccaaatctgactcctaacacccacttaataccagttatctttttaggcatgtaaaatggtggataatgctctttgtt 30281626  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    ||||||||  |||||||||||||||| ||||||||| | | |||||||||||||| |||||||||| || |||||||    
30281625 gctatcatatgaatcatcaccatcattctctaaaagtatttgtttgaaacgattcaaaaactaaaatgatttgtttg 30281549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 502 - 647
Target Start/End: Original strand, 17983945 - 17984090
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||| |||||||||||||| ||| ||||||||| || ||||| ||||||||||||||||||||||||||||| |||||| ||| ||||||| |||||| |    
17983945 cttctttgaactcatctttggtaccaaatctgattcataacacccacttaaaattagtcatctttttaggcatgacaaatggtagataatgctctttgtt 17984044  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttg 647  Q
    ||||||||| |||||||||| ||||| || |||||||||| |||||    
17984045 gctatcatctgaatcatcactatcattctgtaaaaggacttgtttg 17984090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 757 - 852
Target Start/End: Original strand, 8141787 - 8141882
Alignment:
757 acctttaaatgcatttgaccaataatatagtacctaaaacctatcttggtagaatcagaagcagagtttgaggacattgattccgatgattcaatt 852  Q
    ||||||| |||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
8141787 acctttagatgcatttgaccaataatatagtaccaaaaatctatcttggtggaatcagaagcagagtttgaggacattgattccgatgattcaatt 8141882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 566 - 684
Target Start/End: Complemental strand, 49973972 - 49973854
Alignment:
566 tttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaa 665  Q
    |||||||| |||||| ||||||||||| |||||| ||||||||||  |||||||| ||||||||| |||||||||| |||||||||||||| ||||||||    
49973972 tttaggcatgacaaatggtggataatgctctttgttgctatcatctaaatcatcatcatcatcctttaaaaggacttgtttgaaacgattcaaaaactaa 49973873  T
666 aaggacttgtttgagactt 684  Q
    ||||| |||||||||||||    
49973872 aaggatttgtttgagactt 49973854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 552 - 677
Target Start/End: Original strand, 17989864 - 17989989
Alignment:
552 aaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaac 651  Q
    |||||||||||||||||||||| ||||||  ||| |||||| | |||| | |||||||   ||||||||||||||||||||||||||||| |||||||||    
17989864 aaattagtcatctttttaggcatgacaaatagtgaataatgctatttgttactatcatttaaatcatcaccatcatcctctaaaaggacttgtttgaaac 17989963  T
652 gattcgaaaactaaaaggacttgttt 677  Q
     |||| ||||||||||||||||||||    
17989964 aattcaaaaactaaaaggacttgttt 17989989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 68; E-Value: 7e-30
Query Start/End: Original strand, 506 - 684
Target Start/End: Complemental strand, 40721433 - 40721263
Alignment:
506 cttgaactcatctttagtatcaaatctgactcgtaacatcca-cttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgct 604  Q
    |||||||||||||||  || |||||||| ||| ||| | ||| | |||||||| | ||||||||||||| |||||| ||||||||||| |||||| ||||    
40721433 cttgaactcatctttgataccaaatctggctcctaatacccaacctaaaattaattatctttttaggcatgacaaatggtggataatgctctttgttgct 40721334  T
605 atcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| ||||||||         ||||||||||||| ||||||||||||||  ||||||||||||||||||||||||||    
40721333 atcatctgaatcatc---------ctctaaaaggacttgtttgaaacgattcagaaactaaaaggacttgtttgagactt 40721263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 502 - 632
Target Start/End: Original strand, 16506835 - 16506965
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||||||||||||| | || ||| |||||||| ||| ||||| ||||||||||| || |||||||||| ||| | |||| ||||||||||| |||||| |    
16506835 cttccttgaactcaaccttggtaccaaatctggctcctaacacccacttaaaatcagccatctttttaagcatggcaaatggtggataatgatctttgtt 16506934  T
602 gctatcatccgaatcatcaccatcatcctct 632  Q
    ||||||||| |||||||||||||||||||||    
16506935 gctatcatctgaatcatcaccatcatcctct 16506965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 38 - 133
Target Start/End: Complemental strand, 7499113 - 7499018
Alignment:
38 tgggaacatcatggcaagaacaagtgcagaagcaagtgccgggcagggaaagtcacatctagtgtcatggaaaataattggtaaactaacgaggtc 133  Q
    |||||| ||||||||||||||||||||||||| |||| |||||  || |||||  |||||| |||||||||||| |||||||||||||| ||||||    
7499113 tgggaatatcatggcaagaacaagtgcagaagaaagttccgggtgggtaaagtggcatctaatgtcatggaaaaaaattggtaaactaaagaggtc 7499018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 12143193 - 12143241
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||    
12143193 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 12143241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 33325848 - 33325896
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||    
33325848 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 33325896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 38473646 - 38473598
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||    
38473646 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 38473598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 53 - 143
Target Start/End: Complemental strand, 7502172 - 7502081
Alignment:
53 aagaacaagtgcagaagcaagtgccgggcagggaaagtcacatctagtgtcatgg-aaaataattggtaaactaacgaggtccttttctctt 143  Q
    |||||||||||||||||||||  || ||| |||||||| || ||||||||||||| |||| |||||||||||||| ||| ||| ||| ||||    
7502172 aagaacaagtgcagaagcaagcaccaggcggggaaagtgacgtctagtgtcatggaaaaaaaattggtaaactaaagagttccctttttctt 7502081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 277
Target Start/End: Complemental strand, 7501741 - 7501635
Alignment:
171 ttgttaaatatccggtatatcggcgctatatcgctcttccgtgtcggattttagagtagacgatacaaaattcaatatgatttagcaacttcgatatttc 270  Q
    |||||||||||||| ||||| ||| |||||  ||  | |||| ||||| ||||| ||||||||||| |||| ||| ||| ||||||||||| ||||||||    
7501741 ttgttaaatatccgttatattggcactatactgccataccgtatcggaatttagggtagacgatacgaaatccaacatggtttagcaactttgatatttc 7501642  T
271 cgaaata 277  Q
     ||||||    
7501641 tgaaata 7501635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 638 - 684
Target Start/End: Complemental strand, 36781190 - 36781144
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||    
36781190 gacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 36781144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 638 - 684
Target Start/End: Original strand, 50690066 - 50690112
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||    
50690066 gacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 50690112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 638 - 684
Target Start/End: Complemental strand, 52067669 - 52067623
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| |||||||||||||||||||||||||||    
52067669 gacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 52067623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 643 - 684
Target Start/End: Original strand, 43396803 - 43396844
Alignment:
643 gtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||||||| |||||||||||||||||||||||||||    
43396803 gtttgaaacgattcaaaaactaaaaggacttgtttgagactt 43396844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 631 - 680
Target Start/End: Complemental strand, 46825465 - 46825416
Alignment:
631 ctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgag 680  Q
    ||||||||||| |||||||||||||| |||| ||||||||||||||||||    
46825465 ctaaaaggacttgtttgaaacgattcaaaaattaaaaggacttgtttgag 46825416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 21965186 - 21965234
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| ||||||||||||||||||||| |||||    
21965186 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 21965234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 26549509 - 26549557
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||| ||||||||| |||||||||||||||||||||||||||    
26549509 aggacttgtttaaaacgattcaaaaactaaaaggacttgtttgagactt 26549557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 28425383 - 28425335
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| ||||||||||||||||||||| |||||    
28425383 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 28425335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 33674138 - 33674186
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||| ||||||| |||||||||||||||||||||||||||    
33674138 aggacttgtttgacacgattcaaaaactaaaaggacttgtttgagactt 33674186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 36157698 - 36157650
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||| ||||||||||||||||    
36157698 aggacttgtttgaaacgattcaaaaactaaaatgacttgtttgagactt 36157650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 40721464 - 40721512
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| ||| |||||||||| |||||||||||||||||||||||||||    
40721464 aggacttgttggaaacgattcaaaaactaaaaggacttgtttgagactt 40721512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 46051571 - 46051619
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| ||||||||||||||||||||| |||||    
46051571 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 46051619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 49094731 - 49094683
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||| ||||||||||||||||    
49094731 aggacttgtttgaaacgattcaaaaactaaaatgacttgtttgagactt 49094683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 644 - 684
Target Start/End: Original strand, 49814429 - 49814469
Alignment:
644 tttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||||||| |||||||||||||||||||||||||||    
49814429 tttgaaacgattcaaaaactaaaaggacttgtttgagactt 49814469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 849 - 884
Target Start/End: Original strand, 8139514 - 8139549
Alignment:
849 aattcacatattcactcacaaccataaatgagtttt 884  Q
    ||||||||||||||||||||||||||||||||||||    
8139514 aattcacatattcactcacaaccataaatgagtttt 8139549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 636 - 678
Target Start/End: Complemental strand, 7608786 - 7608744
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    |||||| |||||||||||||| |||||||||||||||||||||    
7608786 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttg 7608744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 638 - 684
Target Start/End: Original strand, 7651785 - 7651831
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| ||||||||||||||||||||| |||||    
7651785 gacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 7651831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 638 - 684
Target Start/End: Original strand, 19315763 - 19315809
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| ||||||||||||||||||||| |||||    
19315763 gacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 19315809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 638 - 684
Target Start/End: Original strand, 25800764 - 25800810
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| ||||||||||||||||||||| |||||    
25800764 gacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 25800810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 636 - 678
Target Start/End: Complemental strand, 25988291 - 25988249
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    |||||| |||||||||||||| |||||||||||||||||||||    
25988291 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttg 25988249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 638 - 684
Target Start/End: Complemental strand, 44978786 - 44978740
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| ||||||||||||||||||||| |||||    
44978786 gacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 44978740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 636 - 678
Target Start/End: Complemental strand, 46095095 - 46095053
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    |||||| |||||||||||||| |||||||||||||||||||||    
46095095 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttg 46095053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 638 - 684
Target Start/End: Complemental strand, 48802349 - 48802303
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| ||||||||||||||||||||| |||||    
48802349 gacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 48802303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 643 - 684
Target Start/End: Original strand, 9962879 - 9962920
Alignment:
643 gtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||||||| |||||||||||||||| ||||||||||    
9962879 gtttgaaacgattcaaaaactaaaaggacttctttgagactt 9962920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 638 - 679
Target Start/End: Original strand, 16705993 - 16706034
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttga 679  Q
    |||| |||||||||||||| ||||||||||||||||||||||    
16705993 gacttgtttgaaacgattcaaaaactaaaaggacttgtttga 16706034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 643 - 684
Target Start/End: Original strand, 18917652 - 18917693
Alignment:
643 gtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||||||  |||||||||||||||||||||||||||    
18917652 gtttgaaacgattaaaaaactaaaaggacttgtttgagactt 18917693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 643 - 684
Target Start/End: Original strand, 21929654 - 21929695
Alignment:
643 gtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||||||| |||| ||||||||||||||||||||||    
21929654 gtttgaaacgattcaaaaattaaaaggacttgtttgagactt 21929695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 643 - 684
Target Start/End: Complemental strand, 45350730 - 45350689
Alignment:
643 gtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||||||| |||| ||||||||||||||||||||||    
45350730 gtttgaaacgattcaaaaattaaaaggacttgtttgagactt 45350689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 5400991 - 5401039
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||| ||||| |||||||||| ||||||||||||||||    
5400991 aggacttgtttgaaaagattcaaaaactaaaaagacttgtttgagactt 5401039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 638 - 678
Target Start/End: Complemental strand, 7553034 - 7552994
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    |||| |||||||||||||| |||||||||||||||||||||    
7553034 gacttgtttgaaacgattcaaaaactaaaaggacttgtttg 7552994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 19274680 - 19274728
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||  ||||||||||||||||||||| |||||    
19274680 aggacttgtttgaaacgatttaaaaactaaaaggacttgtttgggactt 19274728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 24204491 - 24204443
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| ||||||||||| || ||||||||||||||||||||| |||||    
24204491 aggacttgtttgaaacgactcaaaaactaaaaggacttgtttgggactt 24204443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 37217017 - 37217065
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||| |||||||||| |||||    
37217017 aggacttgtttgaaacgattcaaaaactaaaatgacttgtttgggactt 37217065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 45670506 - 45670458
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||||||||| |||| |||||    
45670506 aggacttgtttgaaacgattcaaaaactaaaaggacttatttgggactt 45670458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 46825652 - 46825700
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||| |||||||||| |||||    
46825652 aggacttgtttgaaacgattcaaaaactaaaaagacttgtttgggactt 46825700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 48669416 - 48669368
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||| ||||||||||||||||| ||||    
48669416 aggacttgtttgaaacgattcaaaaattaaaaggacttgtttgaaactt 48669368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 50533504 - 50533552
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||  ||||||||||||||||||||| |||||    
50533504 aggacttgtttgaaacgatttaaaaactaaaaggacttgtttgggactt 50533552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 638 - 681
Target Start/End: Original strand, 52147116 - 52147159
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgaga 681  Q
    |||| |||||||||||||| |||| |||||||||||||||||||    
52147116 gacttgtttgaaacgattcaaaaattaaaaggacttgtttgaga 52147159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 638 - 684
Target Start/End: Original strand, 6711563 - 6711609
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| ||||  |||||||||||||||||||||    
6711563 gacttgtttgaaacgattcaaaaataaaaaggacttgtttgagactt 6711609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 465 - 495
Target Start/End: Original strand, 9878784 - 9878814
Alignment:
465 gaatcgtttcaaacaagtcatattgtagata 495  Q
    |||||||||||||||||||||||||||||||    
9878784 gaatcgtttcaaacaagtcatattgtagata 9878814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 638 - 684
Target Start/End: Complemental strand, 18782107 - 18782061
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||| ||||| ||||||||||||||||||||| |||||    
18782107 gacttgtttgaaatgattcaaaaactaaaaggacttgtttgggactt 18782061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 636 - 678
Target Start/End: Original strand, 18892450 - 18892492
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    |||||| |||||||||||||| |||||||||||||||| ||||    
18892450 aggacttgtttgaaacgattcaaaaactaaaaggacttttttg 18892492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 638 - 684
Target Start/End: Complemental strand, 23767432 - 23767387
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| ||||||||||||| |||||||||||||    
23767432 gacttgtttgaaacgattcaaaaactaaaagga-ttgtttgagactt 23767387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 638 - 684
Target Start/End: Original strand, 26070015 - 26070061
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||| |||||||||||||| ||||||||||||| || ||||||||||    
26070015 gacttgtttgaaacgattcaaaaactaaaaggatttctttgagactt 26070061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 643 - 684
Target Start/End: Complemental strand, 16505250 - 16505209
Alignment:
643 gtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||| ||||||||||||||||||||| |||||    
16505250 gtttgaaacaattcaaaaactaaaaggacttgtttgggactt 16505209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 643 - 684
Target Start/End: Complemental strand, 22351138 - 22351097
Alignment:
643 gtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||| ||||||||||||||||||||| |||||    
22351138 gtttgaaacaattcaaaaactaaaaggacttgtttgggactt 22351097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 643 - 676
Target Start/End: Complemental strand, 23228207 - 23228174
Alignment:
643 gtttgaaacgattcgaaaactaaaaggacttgtt 676  Q
    |||||||||||||| |||||||||||||||||||    
23228207 gtttgaaacgattcaaaaactaaaaggacttgtt 23228174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 139; Significance: 3e-72; HSPs: 77)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 3e-72
Query Start/End: Original strand, 465 - 684
Target Start/End: Complemental strand, 14717746 - 14717517
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
14717746 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 14717647  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||| ||||||||||||    
14717646 ttagtcatctttttaggcatgacaaatggtggataatgttctttgttgctatcatctgaatcatcaccatcatcctctaaaaagacttgtttgaaacgat 14717547  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||||||||||||||||||||    
14717546 tcaaaaactaaaaggacttgtttgagactt 14717517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 14952418 - 14952236
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| |||||||||||| ||| ||||| ||||||||||||||||||||||||||||| | |||| |||||||||||||||||| |    
14952418 cttccttgaactcatctttggtatcaaatctggctcctaacacccacttaaaattagtcatctttttaggcatggcaaatggtggataatgttctttgtt 14952319  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||    
14952318 gctatcatctgaatcaacaccatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 14952236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 127; E-Value: 4e-65
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 6740002 - 6740184
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
6740002 cttccttgaactcatctttggtaccaaatctgcctcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 6740101  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||||||||  |||||||||| ||||||||||||||||    
6740102 gctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacgatttaaaaactaaaaagacttgtttgagactt 6740184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 127; E-Value: 4e-65
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 23128913 - 23129142
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||| |||||||||||||          ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
23128913 gaatcgtttcaaacaagtcatatcgtagatagcataattggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacaaccacttaaaa 23129012  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| || ||| ||||||||||| |||||| |||||||||| ||||||||||||| ||||||||||| |||| ||||||||||||    
23129013 ttagtcatctttttaggcatgataaatggtggataatgctctttgctgctatcatctgaatcatcaccattatcctctaaaatgacttgtttgaaacgat 23129112  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||||||||||||| ||||||    
23129113 tcaaaaactaaaaggacttgttttagactt 23129142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 127; E-Value: 4e-65
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 31710376 - 31710194
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
31710376 cttccttgaactcatctttggtaccaaatctggctcctaacatccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 31710277  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||| ||||||||| ||| |||||||||||||| |||||||||| ||||||||||||||||    
31710276 gctatcatctgaatcatcaccatcattctctaaaagaacttgtttgaaacgattcaaaaactaaaatgacttgtttgagactt 31710194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 123; E-Value: 1e-62
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 6331471 - 6331289
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |||||| |||| |||||| |||||| |    
6331471 cttccttgaactcatctttggtaccaaatctgactcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtgaataatgctctttgtt 6331372  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
     ||||||||  ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||    
6331371 actatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 6331289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 123; E-Value: 1e-62
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 30297749 - 30297978
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||| ||||||||||| ||| |||||||| ||| || || ||||||||||    
30297749 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttcaactcatctttggtaccaaatctggctcctagcacccacttaaaa 30297848  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |||||| ||||||||||| |||||| |||||||||| ||||||||||||||||||| |||||||||| ||||||||||||    
30297849 ttagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctgaatcatcaccatcatcctttaaaaggacttgtttgaaacgat 30297948  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || ||||||||||||||||||||| |||||    
30297949 tcaaaaactaaaaggacttgtttgggactt 30297978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 123; E-Value: 1e-62
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 33760470 - 33760699
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcata----------acttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||          ||||| |||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
33760470 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattacttctttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 33760569  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||||||||||| || |||||| ||||||||||| |||||| ||||||||||  ||||||||||||||||||||||||||| | ||||||||||||    
33760570 ttagtcatctttttagtcatgacaaatggtggataatgctctttgttgctatcatctaaatcatcaccatcatcctctaaaaggaattgtttgaaacgat 33760669  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || ||||||||||||||||||||| |||||    
33760670 tcaaaaactaaaaggacttgtttgggactt 33760699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 123; E-Value: 1e-62
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 39824650 - 39824468
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||||||||||| |||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
39824650 cttccttgaacttatctttggtaccaaatctgcctcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 39824551  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||| |||||    
39824550 gctatcatctgaatcatcaccatcatcctctaaaagtacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 39824468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 466 - 684
Target Start/End: Complemental strand, 30863393 - 30863165
Alignment:
466 aatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaat 555  Q
    ||||||||||||||||||||| |||||||||||||           |||| |||||||||||||| ||| |||||||| ||| ||||| |||||||||||    
30863393 aatcgtttcaaacaagtcataatgtagatagcatagttggtaattgcttctttgaactcatctttggtaccaaatctggctcctaacacccacttaaaat 30863294  T
556 tagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgatt 655  Q
    |||||||||||||||||| |||||| ||||||||||| |||||| |||||||||| ||||||||||||||| |||||||||| ||| |||||||||||||    
30863293 tagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctgaatcatcaccatcagcctctaaaagaacttgtttgaaacgatt 30863194  T
656 cgaaaactaaaaggacttgtttgagactt 684  Q
    | |||||||||| ||||||||||||||||    
30863193 caaaaactaaaacgacttgtttgagactt 30863165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 121; E-Value: 2e-61
Query Start/End: Original strand, 465 - 678
Target Start/End: Complemental strand, 8216041 - 8215818
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||| ||| ||| |||||||| ||| ||||| ||||||||||    
8216041 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcatttttggtaccaaatctggctcctaacacccacttaaaa 8215942  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||| | |||||| ||||||||||| |||||| ||||||||||  ||||||||||||||||||||||||||||| ||||||||||||    
8215941 ttagtcatctttttaggaatgacaaatggtggataatgctctttgttgctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 8215842  T
655 tcgaaaactaaaaggacttgtttg 678  Q
    || |||||||||||||||||||||    
8215841 tcaaaaactaaaaggacttgtttg 8215818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 121; E-Value: 2e-61
Query Start/End: Original strand, 502 - 678
Target Start/End: Original strand, 20079305 - 20079480
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||  |||||||||| |||||| |    
20079305 cttccttgaactcatctttagtaccaaatctgactcctaacacccacttaaaattagtcatctttttaggcatgacaaattgtggataatgctctttgtt 20079404  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttg 678  Q
    ||||||||| |||| ||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||    
20079405 gctatcatctgaattatcaccatcatcctctaaaagga-ttgtttgaaacgattcaaaaactaaaaggacttgtttg 20079480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 6600136 - 6600365
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||||||| ||| |||||||| ||  ||||| ||||||||||    
6600136 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctggcttctaacacccacttaaaa 6600235  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| |  ||| |||||||||||||||||| |||||||||| |||| |||||||||||||||||| |||||| |||||||| |||    
6600236 ttagtcatctttttaggcatggtaaatggtggataatgttctttgttgctatcatctgaattatcaccatcatcctctaagaggacttgtttgaaatgat 6600335  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||||||||||||||||||||    
6600336 tcaaaaactaaaaggacttgtttgagactt 6600365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 11000728 - 11000957
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
11000728 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 11000827  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||  | |||  ||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||    
11000828 ttagtcatctttttaggcctggcaagtggtggataatgctctttgttgctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 11000927  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || ||||||||||||| ||||||| |||||    
11000928 tcaaaaactaaaaggatttgtttgggactt 11000957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 16752210 - 16752028
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| ||||||||  || ||||||||||||||||| ||||||||||||||||| |||||| |||| |||||| |||||| |    
16752210 cttccttgaactcatctttggtaccaaatctggatcctaacatccacttaaaatcagtcatctttttaggcatgacaaatggtgaataatgctctttgtt 16752111  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||| |||||||||||||||    
16752110 gctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacaattcaaaaactaaaagaacttgtttgagactt 16752028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 465 - 684
Target Start/End: Complemental strand, 20408674 - 20408445
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           |||| |||||||||| ||| ||| |||||||  ||| ||||| || |||||||    
20408674 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttcattgaactcatatttggtaccaaatctagctcctaacacccgcttaaaa 20408575  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||||| | |||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||    
20408574 ttagtcatctttttaggcatggcaaatggtggataatgttctttgttgctatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 20408475  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || ||||||||||||||||||||| |||||    
20408474 tcaaaaactaaaaggacttgtttgggactt 20408445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 115; E-Value: 6e-58
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 35342274 - 35342092
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| |||||||||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
35342274 cttccttgaactcatctttggtatcaaatctggctcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 35342175  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||| | ||||||||||||||||| | |||||||| | |||||||||||||| ||||||||||||||||| ||| |||||    
35342174 gctatcaactgaatcatcaccatcatcttttaaaaggatttgtttgaaacgattcaaaaactaaaaggacttgattgggactt 35342092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 115; E-Value: 6e-58
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 38964114 - 38964342
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||||||||           ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
38964114 gaatcgtttcaaacaagtcatattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 38964213  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||| |||||||||| |||||| ||||||||||| |||||| ||||||||||  ||||||||||||||||||||||||||| | ||||||||||||    
38964214 ttagtcat-tttttaggcatgacaaatggtggataatgctctttgttgctatcatctaaatcatcaccatcatcctctaaaaggatttgtttgaaacgat 38964312  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||| || ||||||| |||||    
38964313 tcaaaaactaaaatgatttgtttgggactt 38964342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 115; E-Value: 6e-58
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 41282436 - 41282254
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| |||||  |||||||||||||||||||||||||||| || ||| ||||||||||| |||||| |    
41282436 cttccttgaactcatctttggtaccaaatctggctcctaacactcacttaaaattagtcatctttttaggcatgataaatggtggataatgctctttgtt 41282337  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  |||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||    
41282336 gctatcatctaaatcatcaccattatcctctaaaaggacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 41282254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 503 - 684
Target Start/End: Complemental strand, 8689665 - 8689484
Alignment:
503 ttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtg 602  Q
    |||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||||||| | ||||  |||||||||| |||||| ||    
8689665 ttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaattagtcatctttttaggcatggcaaatagtggataatgctctttgttg 8689566  T
603 ctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||| |||||||||||||||| |||||||| |||| |||||||||||||| |||||||||||||||| ||||||||||    
8689565 ctatcatctgaatcatcaccatcattctctaaaaagacttgtttgaaacgattcaaaaactaaaaggacttttttgagactt 8689484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 3352049 - 3352230
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||| ||| ||| ||||| || ||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |    
3352049 cttccttgaactcatatttggtaccaaatttggctcctaacacccacttaaaattagtcatctttttaggcatgacaaagggtggataatgctctttgtt 3352148  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||||| || |||||||||| |||||||||||||| |||||||||||||||||| || |||||    
3352149 gctatcatctgaatcatcaccatcattct-taaaaggacttgtttgaaacgattcaaaaactaaaaggacttgtatgggactt 3352230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 16095960 - 16096188
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||||||  ||| |||||||| ||| ||||| ||||||||||    
16095960 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcatcttg-gtaccaaatctggctcctaacacccacttaaaa 16096058  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||||||||||||||||| | |||||| ||||||||||| |||||| ||||||||||  ||||||||||||||||||||||||||||| ||||||||||||    
16096059 ttagtcatctttttaggtatgacaaatggtggataatgctctttgttgctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgat 16096158  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||||||||| || ||||||| |||||    
16096159 tcaaaaactaaaatgatttgtttgggactt 16096188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 40075044 - 40074862
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||| |||||||||||||| |||  ||||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |    
40075044 cttcattgaactcatctttggtactaaatctggctcctaacacccacttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgtt 40074945  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| ||||||||||||||||||| |||||||||| |||||||||||||| |||| |||||| ||||||||| |||||    
40074944 gctatcatctgaatcatcaccatcatcctgtaaaaggacttgtttgaaacgattcaaaaattaaaagaacttgtttgggactt 40074862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 42993612 - 42993430
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| ||||| || ||| ||||| ||||||||||||||||||||||||||||| |  ||| ||||||||||| |||||| |    
42993612 cttccttgaactcatctttggtaccaaatttggctcctaacacccacttaaaattagtcatctttttaggcatggtaaatggtggataatgctctttgtt 42993513  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
     |||||||| |||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||| |||||    
42993512 actatcatctgaatcatcaccatcatcctctaaaaggacttgtttgaaacaattcaaaaactaaaaggacttgtttgtgactt 42993430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 11692147 - 11692376
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||| ||||||||||           |||||||||||||||||||  || |||||||| ||| ||||| ||||||||||    
11692147 gaatcgtttcaaacaagtcatattgcagatagcatagttggtaattgcttccttgaactcatctttgataccaaatctgcctcctaacacccacttaaaa 11692246  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||||||||||||||  ||||| ||||||||||| |||||| ||||| |||  |||||| |||||||||||| |||||||| | ||||||||||||    
11692247 ttagtcatctttttaggcatcacaaatggtggataatgctctttgttgctaacatttgaatcaccaccatcatcctttaaaaggatttgtttgaaacgat 11692346  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || |||| ||||||||||||||||||||||    
11692347 tcaaaaattaaaaggacttgtttgagactt 11692376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 507 - 684
Target Start/End: Original strand, 19398245 - 19398422
Alignment:
507 ttgaactcatctttagtatcaaatct-gactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgcta 605  Q
    |||||||||||||| ||| ||||||| | ||| ||||| ||||||||||||||||||||||||||| | |||||| |||||||||||||||||| | |||    
19398245 ttgaactcatctttggtaccaaatctagcctc-taacacccacttaaaattagtcatctttttaggtatgacaaatggtggataatgttctttgttacta 19398343  T
606 tcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||| ||||||||| |||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||    
19398344 tcatctgaatcatcatcatcatcctctaaaaggacttgtttgaaacaattcaaaaactaaaaggacttgtttgagactt 19398422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 506 - 684
Target Start/End: Original strand, 26035397 - 26035575
Alignment:
506 cttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgcta 605  Q
    ||||||||||||||| ||| ||||| || ||| ||| | ||||||||||| |||||||||||||||||||||||| ||||||||||| |||||| |||||    
26035397 cttgaactcatctttggtaccaaatatggctcctaatacccacttaaaatcagtcatctttttaggcacgacaaatggtggataatgctctttgttgcta 26035496  T
606 tcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||  ||||||||| ||||||||||||||||||| |||||||||||||| |||||||||| |||||||||| |||||    
26035497 tcatctaaatcatcactatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaatgacttgtttgggactt 26035575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 107; E-Value: 4e-53
Query Start/End: Original strand, 465 - 684
Target Start/End: Original strand, 26593280 - 26593509
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||||||||           |||| ||||||| |||||| ||| |||||||| ||| ||||| ||||||||||    
26593280 gaatcgtttcaaacaagtcatattgtagatagcatagttggtaattgcttctttgaacttatctttggtaccaaatctggctcctaacacccacttaaaa 26593379  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    ||| ||||||||||||||| |||||| ||||||||||| |||||| ||||||||||  || ||||||||| |||||||||||||||| ||||||||||||    
26593380 ttaatcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctaaaccatcaccattatcctctaaaaggacttgtttgaaacgat 26593479  T
655 tcgaaaactaaaaggacttgtttgagactt 684  Q
    || ||||| |||| |||||||||| |||||    
26593480 tcaaaaaccaaaatgacttgtttgggactt 26593509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 465 - 647
Target Start/End: Original strand, 39002025 - 39002217
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    |||| |||||||||||||||||||||||||||||||           ||||||||||||||||||| ||| |||||||| ||| ||||| ||||||||||    
39002025 gaattgtttcaaacaagtcatattgtagatagcatagttggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccacttaaaa 39002124  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttg 647  Q
    ||||||||||||||||||| |||||| ||||||||||| | |||| |||||||||| |||||||||||||||||||||||||||||| |||||    
39002125 ttagtcatctttttaggcatgacaaatggtggataatgctatttgttgctatcatctgaatcatcaccatcatcctctaaaaggacttgtttg 39002217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 502 - 681
Target Start/End: Original strand, 4015921 - 4016099
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||||||| ||| |||||||| ||| ||||| | |||||||||||||||| |||||||||| || ||| ||||||||||| |||||  |    
4015921 cttccttgaactcatctttggtaccaaatctggctcctaacacctacttaaaattagtcatatttttaggcatgataaatggtggataatgctctttt-t 4016019  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgaga 681  Q
     ||||||||  |||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||||    
4016020 actatcatctaaatcatcaccatcatcctctaaaatgacttgtttgaaacgattcaaaaactaaaaggacttgtttgaga 4016099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 547 - 684
Target Start/End: Complemental strand, 27510027 - 27509890
Alignment:
547 acttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggttt 646  Q
    ||||||||||||||||||||||||||| |||||| ||||||||||| |||||| |||||||||| ||||||||||||||||||||||||| |||  ||||    
27510027 acttaaaattagtcatctttttaggcatgacaaatggtggataatgctctttgttgctatcatctgaatcatcaccatcatcctctaaaatgacctgttt 27509928  T
647 gaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||| |||||||||| |||||||| |||||||    
27509927 gaaacgattcaaaaactaaaatgacttgttcgagactt 27509890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 28078452 - 28078634
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||||||||||||||||||  || |||||||| ||| ||||| ||||||||||||||| | ||  ||||||| |||||| ||| ||||||| |||||| |    
28078452 cttccttgaactcatctttgataccaaatctggctcctaacacccacttaaaattagtaaactaattaggcatgacaaatggtagataatgctctttgtt 28078551  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| |||||||||||||| |||||||||| |||| ||||||||| |||| ||||||||||||| ||||||| |||||    
28078552 gctatcatctgaatcatcaccatcttcctctaaaaagacttgtttgaaacaattcaaaaactaaaaggatttgtttgggactt 28078634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 502 - 684
Target Start/End: Complemental strand, 1052627 - 1052448
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||||||||||||||| || ||| |||||||| ||| ||||| ||||||||||||| ||||||||||| ||| | |||| |||||||   | |||||| |    
1052627 cttccttgaactcatccttggtaccaaatctggctcctaacacccacttaaaattactcatctttttaagcatggcaaatggtggat---gctctttgtt 1052531  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||| | |||||||||||||||||||||||||||| |||||||||||||| ||||||||||  |||| ||||||||||    
1052530 gctatcatctgtatcatcaccatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaaaaacttatttgagactt 1052448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 88; E-Value: 8e-42
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 27116146 - 27116322
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    ||||||||||||||| ||| ||| |||||||| ||| |||||||||||| ||||||||||||||||||||||  |||||  ||||||||||||||||| |    
27116146 cttccttgaactcatatttggtaccaaatctggctcctaacatccacttcaaattagtcatctttttaggcattacaaatcgtggataatgttctttgtt 27116245  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  |||      |||||||||||||||||||| |||||||||||||| ||||||||||| ||||| ||| |||||    
27116246 gctatcatcttaat------catcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaagaacttggttgggactt 27116322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 465 - 677
Target Start/End: Complemental strand, 8695007 - 8694785
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataact----------tccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    |||| |||||||||||||| ||||||||||||||||| |          || |||||||||||||||||| |||||||| ||| ||| |  |||||||||    
8695007 gaattgtttcaaacaagtcctattgtagatagcataattgataattatttcattgaactcatctttagtaccaaatctggctcataatactcacttaaaa 8694908  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgat 654  Q
    |||||||| || ||||||| || ||| ||||||||||| |||||| |||||||||  ||||||||||||||||||| |||||   || ||||||||||||    
8694907 ttagtcatgttcttaggcatgataaatggtggataatgctctttgttgctatcatttgaatcatcaccatcatcctttaaaaaagcttgtttgaaacgat 8694808  T
655 tcgaaaactaaaaggacttgttt 677  Q
    || |||||||||| || ||||||    
8694807 tcaaaaactaaaatgatttgttt 8694785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 506 - 684
Target Start/End: Complemental strand, 445044 - 444866
Alignment:
506 cttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgcta 605  Q
    ||||||||||||||| ||||||||| |||||| ||| | ||||||||||| |||| |||||||||||  | |||| ||||||| ||| |||||  || ||    
445044 cttgaactcatctttggtatcaaatatgactcctaaaacccacttaaaatcagtcgtctttttaggcgtggcaaatggtggatcatgatctttattgtta 444945  T
606 tcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||| | ||||||| ||||||||||||||| || | |||||||||||||| ||||||||||||| |||||| ||||||    
444944 tcatctggatcatcaacatcatcctctaaaatgatttgtttgaaacgattcaaaaactaaaaggatttgtttaagactt 444866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 502 - 684
Target Start/End: Original strand, 30208449 - 30208626
Alignment:
502 cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggt 601  Q
    |||||||||||||||||||  || ||||| || ||| ||||| | ||||||||||| ||||||||||||||| || ||| ||||||||||| |||||| |    
30208449 cttccttgaactcatctttgataccaaatttggctcctaacacctacttaaaattaatcatctttttaggcatgataaatggtggataatgctctttgtt 30208548  T
602 gctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||  |||||||||||||||||||||||| |||| ||||     ||||| ||||||||||||| ||||||| |||||    
30208549 gctatcatctaaatcatcaccatcatcctctaaaaagacttgttt-----gattcaaaaactaaaaggaattgtttgggactt 30208626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 506 - 684
Target Start/End: Original strand, 43166320 - 43166489
Alignment:
506 cttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtgcta 605  Q
    ||||||||||||||| ||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |||||| | ||||||||| |||||| | |||    
43166320 cttgaactcatctttggtaccaaatctgactcataacacccacttaaaattagtcatctttttaggcatgacaaatgatggataatgctctttgtttcta 43166419  T
606 tcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||   |         |||||||||||||| |||| |||||||||||||| ||||||||||||| |||||||||||||    
43166420 tcatttaa---------atcatcctctaaaaagacttgtttgaaacgattcaaaaactaaaaggatttgtttgagactt 43166489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 465 - 648
Target Start/End: Original strand, 27457197 - 27457389
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||||||||||||||| ||||           ||||||||||||||||||| ||| |||||||| ||| ||||| |||||| |||    
27457197 gaatcgtttcaaacaagtcatattgtagataacatagttggtaattgcttccttgaactcatctttggtaccaaatctggctcctaacacccactttaaa 27457296  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttga 648  Q
    ||||||||||||||||||| | |||| ||||||||||| |||||| ||| | |||  ||||||||| |||||||||||||||| ||| ||||||    
27457297 ttagtcatctttttaggcatggcaaatggtggataatgctctttgttgcca-catttgaatcatcatcatcatcctctaaaagaacttgtttga 27457389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 465 - 610
Target Start/End: Complemental strand, 6252113 - 6251958
Alignment:
465 gaatcgtttcaaacaagtcatattgtagatagcataa----------cttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaa 554  Q
    ||||||||||||||||||| ||||||||||||||||           ||||||||||||||| ||| ||| |||||||| ||  ||||| ||||||||||    
6252113 gaatcgtttcaaacaagtcctattgtagatagcatagttggtaattgcttccttgaactcatttttggtaccaaatctgccttctaacacccacttaaaa 6252014  T
555 ttagtcatctttttaggcacgacaaagggtggataatgttctttggtgctatcatc 610  Q
    ||||||||||||||||||| |||||| |||| |||||| |||||| ||||||||||    
6252013 ttagtcatctttttaggcatgacaaatggtgaataatgctctttgttgctatcatc 6251958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 594 - 684
Target Start/End: Original strand, 19661770 - 19661860
Alignment:
594 tctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| ||||||||||  ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||  ||||||||| |||||    
19661770 tctttgttgctatcatctaaatcatcaccatcatcctctaaaaggacttgtttgaaacgattcaaaaactaaaaaaacttgtttgggactt 19661860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 603 - 684
Target Start/End: Original strand, 37923546 - 37923627
Alignment:
603 ctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    ||||||||  |||||||||||||||||| |||||||||| |||||||||||||| || ||||||||||||||||||||||||    
37923546 ctatcatctaaatcatcaccatcatcctttaaaaggacttgtttgaaacgattcaaacactaaaaggacttgtttgagactt 37923627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 503 - 647
Target Start/End: Complemental strand, 11935538 - 11935395
Alignment:
503 ttccttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttggtg 602  Q
    |||||||| ||||||||| | | ||||| || ||| |||||  ||||||||||||| ||||||||||||||  |||||  |||||||||| |||||| ||    
11935538 ttccttgatctcatcttt-gaaccaaatgtggctcctaacactcacttaaaattagccatctttttaggcataacaaatagtggataatgatctttgttg 11935440  T
603 ctatcatccgaatcatcaccatcatcctctaaaaggactggtttg 647  Q
     |||||||  |||||||||||||||||||||||| |||| |||||    
11935439 ttatcatctaaatcatcaccatcatcctctaaaatgacttgtttg 11935395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 183 - 313
Target Start/End: Complemental strand, 22210544 - 22210414
Alignment:
183 cggtatatcggcgctatatcgctcttccgtgtcggattttagagtagacgatacaaaattcaatatgatttagcaacttcgatatttccgaaatatcagc 282  Q
    ||||||||||||||| || | || ||| |||||| | ||||   ||||||||||||||  ||||| |||| ||||| || ||||||||||||||||| ||    
22210544 cggtatatcggcgctttaccactattctgtgtcgaaatttacgatagacgatacaaaacccaatacgattaagcaattttgatatttccgaaatatcggc 22210445  T
283 gagattgcacaaatctggtatatcagtcatg 313  Q
    |||||||||||| || |||||||||||||||    
22210444 gagattgcacaattccggtatatcagtcatg 22210414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 507 - 599
Target Start/End: Original strand, 19659553 - 19659645
Alignment:
507 ttgaactcatctttagtatcaaatctgactcgtaacatccacttaaaattagtcatctttttaggcacgacaaagggtggataatgttctttg 599  Q
    |||||||||||||| ||| |||||||| ||| ||| | ||||||||||||||||||||||||||||| ||||||  |||||||||| ||||||    
19659553 ttgaactcatctttggtaccaaatctggctcctaatacccacttaaaattagtcatctttttaggcatgacaaattgtggataatgctctttg 19659645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 582 - 684
Target Start/End: Complemental strand, 20517172 - 20517070
Alignment:
582 ggtggataatgttctttggtgctatcatccgaatcatcaccatcatcctctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgaga 681  Q
    ||||||||||| | |||| |||||| |||  |||||||| ||||||||||||||||||||  |||||||| |||| |||||||||| |||||||||| ||    
20517172 ggtggataatgctttttgttgctataatctaaatcatcatcatcatcctctaaaaggacttatttgaaacaattcaaaaactaaaaagacttgtttggga 20517073  T
682 ctt 684  Q
    |||    
20517072 ctt 20517070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 630 - 684
Target Start/End: Complemental strand, 6251959 - 6251905
Alignment:
630 tctaaaaggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||| |||||    
6251959 tctaaaaggacttgtttgaaacgattcaaaaactaaaaggacttgtttgggactt 6251905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 6252093 - 6252141
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||    
6252093 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 6252141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 11000748 - 11000700
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||    
11000748 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 11000700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 636 - 684
Target Start/End: Original strand, 11935566 - 11935614
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||    
11935566 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 11935614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 636 - 684
Target Start/End: Complemental strand, 30297769 - 30297721
Alignment:
636 aggactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt 684  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||    
30297769 aggacttgtttgaaacgattcaaaaactaaaaggacttgtttgagactt 30297721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 638 - 684
Target Start/End: Complemental strand, 26593298 - 26593252
Alignment:
638 gactggtttgaaacgattcgaaaactaaaaggacttgtttgagactt