View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-25 (Length: 1006)

Name: R108-tnk148-25
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-25
R108-tnk148-25
[»] chr3 (2 HSPs)
chr3 (47-545)||(8522504-8523002)
chr3 (544-999)||(8523042-8523493)
[»] chr6 (4 HSPs)
chr6 (53-545)||(25523231-25523726)
chr6 (54-340)||(24140436-24140722)
chr6 (738-972)||(25522927-25523161)
chr6 (554-843)||(24140921-24141206)
[»] chr4 (2 HSPs)
chr4 (53-545)||(11117538-11118036)
chr4 (603-972)||(11118106-11118473)
[»] chr5 (21 HSPs)
chr5 (47-545)||(34240757-34241255)
chr5 (49-545)||(34232986-34233482)
chr5 (47-545)||(42117130-42117631)
chr5 (41-545)||(42122881-42123385)
chr5 (47-545)||(42128276-42128773)
chr5 (673-983)||(42128835-42129145)
chr5 (137-545)||(41572300-41572708)
chr5 (137-545)||(41617939-41618347)
chr5 (66-450)||(41713768-41714152)
chr5 (540-983)||(42117714-42118152)
chr5 (740-972)||(34240443-34240675)
chr5 (672-961)||(34232632-34232924)
chr5 (667-972)||(42123461-42123766)
chr5 (110-207)||(41444084-41444181)
chr5 (541-698)||(41713260-41713413)
chr5 (541-646)||(41571722-41571824)
chr5 (893-974)||(41713612-41713693)
chr5 (863-938)||(41572040-41572115)
chr5 (863-938)||(41617679-41617754)
chr5 (509-545)||(41714176-41714212)
chr5 (554-633)||(34240261-34240338)
[»] chr2 (7 HSPs)
chr2 (540-979)||(12248416-12248851)
chr2 (40-545)||(11994584-11995093)
chr2 (40-545)||(12247837-12248345)
chr2 (603-994)||(11994139-11994528)
chr2 (53-245)||(32682113-32682311)
chr2 (676-972)||(32681747-32682043)
chr2 (403-545)||(9423281-9423424)


Alignment Details
Target: chr3 (Bit Score: 439; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 47 - 545
Target Start/End: Complemental strand, 8523002 - 8522504
Alignment:
47 tactatgattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttg 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||    
8523002 tactatgattctgtgattgtggcgacaaaagggaacaaaatgaaactagtgaaaattccaaacaactttgtaattattgatttgtcaagaaacaaatttg 8522903  T
147 aaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaa 246  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
8522902 aaggcgagattccaaagattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattcccaaatccataggaaa 8522803  T
247 cttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttggatctt 346  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||    
8522802 cttgacatacttggaatctttggatctttcctcaaatatgttaaccgatgtgattcctttggaattaaccaatcttaacagtcttgaagtcttggatctt 8522703  T
347 tccaataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattaccct 446  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8522702 tccaataatcgtcttgtgggagaaatacctcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattaccct 8522603  T
447 tgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaacttttgcggtgaggagaaatttggatttggatggaaaccagtggcaattg 545  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||| ||||||||||||||||||||||||||    
8522602 tgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaacttttgcagtgaagagaagtttgaatttggatggaaaccagtggcaattg 8522504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 312; E-Value: 1e-175
Query Start/End: Original strand, 544 - 999
Target Start/End: Complemental strand, 8523493 - 8523042
Alignment:
544 tgacaggcaccattccacaatgtcttactaatttatcatccccttgaagttttgggatttacaaatgaacaagtttcatgacactttgccaaggtaactt 643  Q
    |||||||||||||||||||||||||| |||||||||||| || |||||||||||| || ||||||||||||| |||||||  ||||||||||| ||||||    
8523493 tgacaggcaccattccacaatgtcttgctaatttatcatacc-ttgaagttttgg-atctacaaatgaacaaatttcatggaactttgccaag-taactt 8523397  T
644 ttccaaaagaaagtgcacttaagactccgaatctctatggcaaccaattagaaggtcatattcctaaatccctgtctctctgtaaacggttaatgtttct 743  Q
    ||| ||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||| |    
8523396 ttc-aaaagaaagtgaacttgagactctgaatctctatggcaaccaattagaaggtcatattcctaaatccttgtctctctgtaaagggttgatgttttt 8523298  T
744 aaatcttgggagcaacaacatagaagacaattttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgcatggt 843  Q
    ||| ||||| | |||||  |||||||||||||||||||||| |||| ||||  |||| ||||||||||||||||||||||||||||||||||||||||||    
8523297 aaaccttggcaacaacataatagaagacaattttcctcattggcttgaaacactgcattatttgaaagtgttgcttttgcgagacaataagttgcatggt 8523198  T
844 atcattgttaatccaaagctcaagcatccatttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagcctatttca 943  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||    
8523197 atcattgttaatccaaagatcaagcatccatttccagatttaactatttttgatatctcaaacaataactttagtggtcctctaccaaaatcctatttca 8523098  T
944 aaaagtttgaagccatgatgaatgttactgagttggaatatatgtggaatagaata 999  Q
    |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||    
8523097 aaaagtttgaagccatgatgaatgttactgagttggaatacatgaggaatagaata 8523042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 53 - 545
Target Start/End: Original strand, 25523231 - 25523726
Alignment:
53 gattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttgaaggag 152  Q
    |||||||||| |||||| ||||||||||   |||||||| |||||||||||||||  |  ||||||  ||||||||| ||||||||||||||||||||||    
25523231 gattctgtgactgtggcaacaaaagggattcaaatgaaattggtgaaaattccaataaagtttgtatctattgatttttcaagaaacaaatttgaaggag 25523330  T
153 agattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaacttgac 252  Q
    ||||||||||   |||||| |||||||||||| ||| |||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||    
25523331 agattccaaatgctattggagagcttcatgcactcaaagggcttaacctttcccacaacagacttaccggtcatattcccaaatccataggaaacttgac 25523430  T
253 atacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttggatctttccaat 352  Q
    ||||||||||| | |||||||||||   ||||||||||||||||||||||||  ||||||||| ||| | |||  |||||||||| || |||||||||||    
25523431 atacttggaatctctggatctttccctgaatatgttaaccggtgtgattcctgcggaattaaccaatttaaactttcttgaagtcatgaatctttccaat 25523530  T
353 aatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattacccttgtcaa 452  Q
    || | | | ||||||| ||||||    |||||||||||||| ||||||||||||||||| ||||||||||||||||  ||||||||||| ||||||||||    
25523531 aaccatttggtgggagaaatacctagaggaaagcaattcaacacatttacaaatgattcctatgaaggaaacttggggttatgtggatttcccttgtcaa 25523630  T
453 aaatgtgtggacctgaacaacattctgcaccttcagccaac---aacttttgcggtgaggagaaatttggatttggatggaaaccagtggcaattg 545  Q
    | |  ||||||| ||||||||||||| |||||||| |||||   ||||||||  |||| |||||||||||||||||||||| ||| |||| |||||    
25523631 agagatgtggacttgaacaacattctccaccttcacccaacaaaaacttttggagtgaagagaaatttggatttggatggataccggtggtaattg 25523726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 159; E-Value: 4e-84
Query Start/End: Original strand, 54 - 340
Target Start/End: Complemental strand, 24140722 - 24140436
Alignment:
54 attctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttgaaggaga 153  Q
    ||||||||| |||||| |||||||||| |||||||| |||||||||||||||||| |  ||||||| ||| ||| |||||||||||||||||||||||||    
24140722 attctgtgactgtggcaacaaaagggaccaaaatgacactggtgaaaattccaaaaaagtttgtaagtatcgatatgtcaagaaacaaatttgaaggaga 24140623  T
154 gattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaacttgaca 253  Q
    |||||||||   ||| || |||||||||||| ||| |||| ||||||||||||||||||||||||| |||||||||||  ||||||| ||||| ||||||    
24140622 gattccaaatgctatcggagagcttcatgcactcaaagggattaacctttcccataacagacttactggtcatattccccaatccatcggaaagttgaca 24140523  T
254 tacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttg 340  Q
    |||||||||| |||| ||||||| ||||||||||||||||| |||||||||| ||||||||| ||| | ||| ||||||||||||||    
24140522 tacttggaatctttgaatctttcatcaaatatgttaaccggcgtgattccttcggaattaaccaatatgaacagtcttgaagtcttg 24140436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 738 - 972
Target Start/End: Original strand, 25522927 - 25523161
Alignment:
738 gtttctaaatcttgggagcaacaacatagaagacaattttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttg 837  Q
    ||||||||| || |||  |||||| |||||||||||||||||  ||| |||||||||  ||||  |||||||||||||| ||||||||||||| ||||||    
25522927 gtttctaaacctcggggtcaacaaaatagaagacaattttccggattggcttcaaacaatgcaggatttgaaagtgttggttttgcgagacaacaagttg 25523026  T
838 catggtatcattgttaatccaaagctcaagcatccatttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagcct 937  Q
    ||||||  | |||| |||  |||  |||||||| |||||| |  |||||  ||||||||||||||| | || || ||  |||||  ||||||||||||||    
25523027 catggttcccttgtcaatttaaaaatcaagcattcatttcaaagtttaatcatttttgatatctcaggtaacaatttaggtggttttctaccaaaagcct 25523126  T
938 atttcaaaaagtttgaagccatgatgaatgttact 972  Q
    |||| | ||| | ||||||||||| ||||||||||    
25523127 atttaagaaattatgaagccatgaagaatgttact 25523161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 554 - 843
Target Start/End: Complemental strand, 24141206 - 24140921
Alignment:
554 cattccacaatgtcttactaatttatcatccccttgaagttttgggatttacaaatgaacaagtttcatgacactttgccaaggtaacttttccaaaaga 653  Q
    |||||||||||||||| || ||| | |||||| | || ||||||  || ||||||| ||||  ||||||| |||||||||||| ||||||||| ||| ||    
24141206 cattccacaatgtctttctgattcaccatcccttcga-gttttga-atctacaaatcaacacatttcatggcactttgccaag-taacttttc-aaagga 24141111  T
654 aagtgcacttaagactccgaatctctatggcaaccaattagaaggtcatattcctaaatccctgtctctctgtaaacggttaatgtttctaaatcttggg 753  Q
     | || | || | |||| |||| ||||||| ||| | |||||||| ||| |||| |||||| ||||||  ||||||   ||   || |||||| || ||     
24141110 caatggaattgacactctgaatttctatggtaacaagttagaaggccattttccgaaatccttgtctcgatgtaaaaatttggagtatctaaacctcggc 24141011  T
754 agcaacaacatagaagacaattttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgcatggt 843  Q
    | |||||| ||||||||||||||| || ||| ||||| |||  ||||||||||| |||| ||| ||||||||||||||||||| ||||||    
24141010 aacaacaaaatagaagacaatttttctgattggcttctaacactgcaatatttggaagtattggttttgcgagacaataagttacatggt 24140921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 53 - 545
Target Start/End: Complemental strand, 11118036 - 11117538
Alignment:
53 gattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttgaaggag 152  Q
    |||||||||| |||||  | ||||||||||||||||| |||||||||||||||||  |  || |||| ||||||||||||||||||||||||||||||||    
11118036 gattctgtgactgtggaaataaaagggaacaaaatgacactggtgaaaattccaataaagttagtaagtattgatttgtcaagaaacaaatttgaaggag 11117937  T
153 agattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaacttgac 252  Q
    ||||| ||||   |||||| |||||||||||| ||| ||||||||| ||||||| |||||||||||| ||||||||||| || ||||||||||||||| |    
11117936 agattacaaatgctattggagagcttcatgcactcaaagggcttaatctttcccgtaacagacttactggtcatattcccaactccataggaaacttggc 11117837  T
253 atacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttggatctttccaat 352  Q
    ||||||||||| |||||||||||| ||||||||||||||| |||||||||||   |||||||| ||| |   |  |||||||||||| ||| |||| |||    
11117836 atacttggaatctttggatctttcatcaaatatgttaaccagtgtgattcctgcagaattaaccaatttgggctttcttgaagtcttagatatttcaaat 11117737  T
353 aatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattacccttgtcaa 452  Q
    || | ||| ||||||| |||||| || |||||||||||||||||||||||||||||||| ||||||||||| |  |  ||||||||||||||||||||||    
11117736 aaccatctagtgggagaaatacctcaaggaaagcaattcaatacatttacaaatgattcctatgaaggaaattcagggttatgtggattacccttgtcaa 11117637  T
453 aaatgtgtggacctgaacaacattctgcaccttcagccaacaacttttgc----gg--tgaggagaaatttggatttggatggaaaccagtggcaattg 545  Q
    | |  ||||||||||||||||||||| |||||||||||||||||| || |    ||  ||| |||||||||||||||||||||||| ||||||||||||    
11117636 agaaatgtggacctgaacaacattctccaccttcagccaacaactcttcctcttggaatgaagagaaatttggatttggatggaaagcagtggcaattg 11117538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 102; E-Value: 4e-50
Query Start/End: Original strand, 603 - 972
Target Start/End: Complemental strand, 11118473 - 11118106
Alignment:
603 tacaaatgaacaagtttcatgacactttgccaaggtaacttttccaaaagaaagtgcacttaagactccgaatctctatggcaaccaattagaaggtcat 702  Q
    ||||||||||||| ||||||| ||||||||| || ||||||||| ||| ||||||    ||  | ||| ||| |||||||||||||| |||||||| |||    
11118473 tacaaatgaacaaatttcatggcactttgcctag-taacttttc-aaaggaaagtcgtattgtgtctctgaacctctatggcaaccagttagaaggccat 11118376  T
703 attcctaaatccctgtctctctgtaaacggttaatgtttctaaatcttgggagcaacaacatagaagacaattttcctcattagcttcaaaccttgcaat 802  Q
     |||| |||||| ||||||  ||||||  |||   ||||||||| || || |||||||  |||||||||| ||||||| ||| ||||||||| |||| |     
11118375 tttccaaaatccttgtctcggtgtaaaaagttggcgtttctaaacctcggcagcaacagaatagaagacagttttcctgattggcttcaaacattgccag 11118276  T
803 atttgaaagtgttgcttttgcgagacaataagttgcatggtatcattgttaatccaaagctcaagcatccatttccagatttaactatttttgatatctc 902  Q
    |||||||||| ||| ||||||||||||||||||||||||||  |||||  |||  |||| || |||||| |||||||   ||||  ||||||||||||||    
11118275 atttgaaagtattggttttgcgagacaataagttgcatggtcccattgaaaatttaaagatcgagcatctatttccaagcttaatcatttttgatatctc 11118176  T
903 aagcaataactttagtggtcctctaccaaaagcctatttcaaaaagtttgaagccatgatgaatgttact 972  Q
      |||| | ||||||||||  |||||||||||||||||| ||||| | |||||| |||| ||||||||||    
11118175 gggcaacagctttagtggttttctaccaaaagcctatttaaaaaactatgaagctatgaagaatgttact 11118106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 227; Significance: 1e-124; HSPs: 21)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-124
Query Start/End: Original strand, 47 - 545
Target Start/End: Original strand, 34240757 - 34241255
Alignment:
47 tactatgattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttg 146  Q
    |||||||||||||||| |||| |||||||||| | |||||||| ||||  |||||||||||  || ||||||| ||||||||| ||||||||||| |||     
34240757 tactatgattctgtgactgtgacgacaaaaggcatcaaaatgacactgacgaaaattccaacaatgtttgtaagtattgatttctcaagaaacaagttta 34240856  T
147 aaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaa 246  Q
    | ||||  ||||||||   ||| || || ||||| ||| ||| ||||||||||||||| ||||||||||| || |||| ||||||  ||||||||  |||    
34240857 atggaggaattccaaatgatataggagaacttcacgcactcaaagggcttaacctttcacataacagactcactggtcctattcctcaatccatacaaaa 34240956  T
247 cttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttggatctt 346  Q
    ||||||| |||||||||  |||||||| || ||||||||| | || ||| ||||||||   |||||||| ||| | ||| ||||||||||||||||||||    
34240957 cttgacaaacttggaatcgttggatctctcgtcaaatatgctcactggtatgattcctgcagaattaaccaatttgaacagtcttgaagtcttggatctt 34241056  T
347 tccaataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattaccct 446  Q
    |||||||| | ||||||||||| |||||| || |||||||||||||||||||||||||||||||||||| |||| |||||||  ||||||||||||||||    
34241057 tccaataaccatcttgtgggagaaatacctcaaggaaagcaattcaatacatttacaaatgattcttataaagggaacttggggttatgtggattaccct 34241156  T
447 tgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaacttttgcggtgaggagaaatttggatttggatggaaaccagtggcaattg 545  Q
    ||||||| |  |||||||| |||||||||||| ||||||||||||||||||||||  |||| ||||||||||| |||||||||||||||||||||||||    
34241157 tgtcaaagaaatgtggaccggaacaacattctccaccttcagccaacaacttttggagtgaagagaaatttggctttggatggaaaccagtggcaattg 34241255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 49 - 545
Target Start/End: Original strand, 34232986 - 34233482
Alignment:
49 ctatgattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttgaa 148  Q
    |||||||||||||| |||||| |  ||||||| ||| |||| | |||| ||||||||||  | |||||||| ||||||||| ||||||||||| ||| |     
34232986 ctatgattctgtgactgtggcaaacaaagggatcaatatgacattggtaaaaattccaataaactttgtaagtattgatttctcaagaaacaagtttaat 34233085  T
149 ggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaact 248  Q
    ||||  ||||||||   ||| || || ||||| ||| ||| ||||||||||||||| ||||||||||| || |||| ||||||  ||||||||  |||||    
34233086 ggaggaattccaaatgatataggagaacttcacgcactcaaagggcttaacctttcacataacagactcactggtcctattcctcaatccatacaaaact 34233185  T
249 tgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttggatctttc 348  Q
    ||||| |||||||||  |||||||| || ||||||||| | || ||| ||||||||   |||||||| ||| | ||| ||||||||||||||||||||||    
34233186 tgacaaacttggaatcgttggatctctcgtcaaatatgctcactggtatgattcctgcagaattaaccaatttgaacagtcttgaagtcttggatctttc 34233285  T
349 caataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattacccttg 448  Q
    |||||| | ||||||||||| |||||| || |||||||||||||||||||||||||||||||||||| |||| |||||||  ||||||||||||||||||    
34233286 caataaccatcttgtgggagaaatacctcaaggaaagcaattcaatacatttacaaatgattcttataaagggaacttggggttatgtggattacccttg 34233385  T
449 tcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaacttttgcggtgaggagaaatttggatttggatggaaaccagtggcaattg 545  Q
    ||||| |  |||||||| |||||||||||| ||||||||||||||||||||||  |||| ||||||||||| |||||||||||||||||||||||||    
34233386 tcaaagaaatgtggaccggaacaacattctccaccttcagccaacaacttttggagtgaagagaaatttggctttggatggaaaccagtggcaattg 34233482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 47 - 545
Target Start/End: Complemental strand, 42117631 - 42117130
Alignment:
47 tactatgattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttg 146  Q
    ||||||||||||||||||||| |||||||||||| |||||||| | ||||||||||||||||||| |||||||||||||||||||||| |||||||||||    
42117631 tactatgattctgtgattgtgtcgacaaaagggagcaaaatgacattggtgaaaattccaaacatttttgtaattattgatttgtcaaaaaacaaatttg 42117532  T
147 aaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaa 246  Q
    | ||||||||||||||   |||||| || || |||||| ||| ||||||||||||||||||||||||||| || ||||||||||| |||||||| |||||    
42117531 agggagagattccaaatgctattggagacctccatgcactcaaagggcttaacctttcccataacagactcaccggtcatattcccaaatccatgggaaa 42117432  T
247 cttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttggatctt 346  Q
    |||| || |||||||||  |||||||| || ||||||||| | |||||| |||| |||   |||||||| ||| |  ||  |||| |||||||| |||||    
42117431 cttgtcaaacttggaatcattggatctctcgtcaaatatgcttaccggtatgatccctgcagaattaaccaatttagactttcttcaagtcttgaatctt 42117332  T
347 tccaataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattaccct 446  Q
    |||||||| | ||| ||||||  |||||| || |    ||| ||| |||||||| |||||||||| ||  |||||||||||| |||||||||||| || |    
42117331 tccaataaccatctagtgggaaaaatacctcaagagccgcacttcgatacatttccaaatgattcctacaaaggaaacttgggtttatgtggatttccgt 42117232  T
447 tgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaa---cttttgcggtgaggagaaatttggatttggatggaaaccagtggcaat 543  Q
    ||||||| || |||||||||||||| |||||| ||  ||||||||||||   ||||||| |||| |||||||||||||||||||||||| ||||||||||    
42117231 tgtcaaagatttgtggacctgaacatcattctccaatttcagccaacaacagcttttgcagtgaagagaaatttggatttggatggaaagcagtggcaat 42117132  T
544 tg 545  Q
    ||    
42117131 tg 42117130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 41 - 545
Target Start/End: Complemental strand, 42123385 - 42122881
Alignment:
41 gcaccctactatgattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaaca 140  Q
    |||| ||||| |||||||||||  ||||| |||||||| | |||||||| ||| || ||||||||||| |  ||||||| ||||||| ||||||||||||    
42123385 gcacactactctgattctgtgaccgtggcaacaaaaggaaccaaaatgacactcgttaaaattccaaaaaagtttgtaagtattgatatgtcaagaaaca 42123286  T
141 aatttgaaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccat 240  Q
    ||||||||||||||||||||||   ||||||  |||| |||||| ||||||||||||||||||||||||||||||| |  |||| ||||||  |||| ||    
42123285 aatttgaaggagagattccaaatgctattggaaagctacatgcactcatagggcttaacctttcccataacagactcaatggtcctattccccaatcaat 42123186  T
241 aggaaacttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttg 340  Q
     ||| ||||| || |||||||||  |||||||| || ||||||||| | || | ||||||||||   ||| |||| ||| |   |  ||||||||||||     
42123185 tggatacttgtcaaacttggaatggttggatctctcatcaaatatgctcactgatgtgattcctgcagaactaaccaatttgggctttcttgaagtctta 42123086  T
341 gatctttccaataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggat 440  Q
    ||| |||| ||||| | ||||||||||| |||||| || |||||||| ||||||||||||||||||||||| ||||||||||| |  |  ||||||||||    
42123085 gatatttcaaataaccatcttgtgggagaaatacctcaaggaaagcagttcaatacatttacaaatgattcctatgaaggaaattcagggttatgtggat 42122986  T
441 tacccttgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaacttttgcggtgaggagaaatttggatttggatggaaaccagtggc 540  Q
    |||||||||||||||  ||||||||||||||||||||| ||||||||||||| |||| |||  |||| ||||||||| ||||||||||||||||||||||    
42122985 tacccttgtcaaaaaaatgtggacctgaacaacattctccaccttcagccaagaactcttggagtgaagagaaatttagatttggatggaaaccagtggc 42122886  T
541 aattg 545  Q
     ||||    
42122885 gattg 42122881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 185; E-Value: 1e-99
Query Start/End: Original strand, 47 - 545
Target Start/End: Complemental strand, 42128773 - 42128276
Alignment:
47 tactatgattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttg 146  Q
    |||||||||||| ||||||||||||||||||||||||||| || | |||||||||||||||| |||||||||||||||||||||||||||||||||||||    
42128773 tactatgattctatgattgtggcgacaaaagggaacaaaaggacattggtgaaaattccaaatatctttgtaattattgatttgtcaagaaacaaatttg 42128674  T
147 aaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaa 246  Q
    ||||||| ||||||||   | ||||||||||||||||| | ||||| || |||||||||||||||| ||| |  || | |||||| |||||||| |||||    
42128673 aaggagatattccaaatgattttggtgagcttcatgcactaataggactcaacctttcccataacaaactcattggccctattccaaaatccatgggaaa 42128574  T
247 cttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttggatctt 346  Q
    ||||||| |||||||||  |||||||| || |||||| || | || | ||||||||||   |||||||  ||| |      |||||||||||| ||||||    
42128573 cttgacaaacttggaatggttggatctctcatcaaatgtgctcactgatgtgattcctgcagaattaagcaatttgggttttcttgaagtcttagatctt 42128474  T
347 tccaataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattaccct 446  Q
    || ||||| | ||| ||||||| |||||| || |||  ||||||||||||||||||||||||||| ||||||||||||||||  ||||||||||| ||||    
42128473 tcaaataaccatctagtgggagaaatacctcaaggaccgcaattcaatacatttacaaatgattcctatgaaggaaacttggggttatgtggatttccct 42128374  T
447 tgtcaaaaatgtgtggacctgaacaacattctgcacct-tcagccaacaacttttgcggtgaggagaaatttggatttggatggaaaccagtggcaattg 545  Q
    ||||||| |  ||||||||||||||  ||||  ||  | |  | |||||||| |||  |||| ||||||||| |||||||||||||||||||||| ||||    
42128373 tgtcaaagaattgtggacctgaaca--attccacaattctttgacaacaactcttggagtgaagagaaatttagatttggatggaaaccagtggcgattg 42128276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 175; E-Value: 1e-93
Query Start/End: Original strand, 673 - 983
Target Start/End: Complemental strand, 42129145 - 42128835
Alignment:
673 aatctctatggcaaccaattagaaggtcatattcctaaatccctgtctctctgtaaacggttaatgtttctaaatcttgggagcaacaacatagaagaca 772  Q
    |||||| |||||||| |||||||||||||| |||| |||||| |||||||||||| |  |||   ||||||||| || || |||||||||||||||||||    
42129145 aatctccatggcaacaaattagaaggtcattttccaaaatccttgtctctctgtacaaagttggagtttctaaacctcggaagcaacaacatagaagaca 42129046  T
773 attttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgcatggtatcattgttaatccaaagctcaagcatcc 872  Q
    |||||||| ||| |||||||||  |||||||||||||||||||| |||||| |||||| ||||||||||||||||||| ||||| |||| ||||||||||    
42129045 attttcctgattggcttcaaacactgcaatatttgaaagtgttggttttgcaagacaacaagttgcatggtatcattgctaatctaaagatcaagcatcc 42128946  T
873 atttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagcctatttcaaaaagtttgaagccatgatgaatgttact 972  Q
    |||||||  ||||| |||||||||||||||| ||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||    
42128945 atttccaagtttaattatttttgatatctcaggcaataactttagcggtccgctaccaaaagcctattttaaaaagtttgaagccatgaagaatgttact 42128846  T
973 gagttggaata 983  Q
     | ||||||||    
42128845 caattggaata 42128835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 137; E-Value: 5e-71
Query Start/End: Original strand, 137 - 545
Target Start/End: Original strand, 41572300 - 41572708
Alignment:
137 aacaaatttgaaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaat 236  Q
    ||||| ||||||||||||||||  ||  ||||||| ||||||||  || ||| ||||||||||||||||||||||||||| || |||| ||||||  |||    
41572300 aacaattttgaaggagagattctgaatgttattggggagcttcactcactcaaagggcttaacctttcccataacagactcaccggtcctattcctcaat 41572399  T
237 ccataggaaacttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagt 336  Q
    || ||||||||||| || || ||||||  ||||||||||| ||||||||  | || ||||| |||||||  |||||||  ||||| |||||| ||| |||    
41572400 ccgtaggaaacttgtcaaacatggaatcattggatctttcgtcaaatatactcactggtgtaattccttcagaattaatcaatctgaacggtattggagt 41572499  T
337 cttggatctttccaataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgt 436  Q
     ||| |||||||  |||| | ||| ||||||| |||||| || ||||| || |||||||||||| | ||||| || ||||||||||||||||  |||||     
41572500 attgaatctttctcataaccatctagtgggagaaatacctcaaggaaaacagttcaatacattttccaatgactcatatgaaggaaacttgggattatgc 41572599  T
437 ggattacccttgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaacttttgcggtgaggagaaatttggatttggatggaaaccag 536  Q
    ||||| ||||||||||| |  |||| |||||||||||||||| | | | || |||||||| ||||  |||| ||||||||||||||||||||||||||||    
41572600 ggatttcccttgtcaaagaaatgtgaacctgaacaacattctccgcttccacccaacaacctttggagtgaagagaaatttggatttggatggaaaccag 41572699  T
537 tggcaattg 545  Q
    |||| ||||    
41572700 tggctattg 41572708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 137; E-Value: 5e-71
Query Start/End: Original strand, 137 - 545
Target Start/End: Original strand, 41617939 - 41618347
Alignment:
137 aacaaatttgaaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaat 236  Q
    ||||| ||||||||||||||||  ||  ||||||| ||||||||  || ||| ||||||||||||||||||||||||||| || |||| ||||||  |||    
41617939 aacaattttgaaggagagattctgaatgttattggggagcttcactcactcaaagggcttaacctttcccataacagactcaccggtcctattcctcaat 41618038  T
237 ccataggaaacttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagt 336  Q
    || ||||||||||| || || ||||||  ||||||||||| ||||||||  | || ||||| |||||||  |||||||  ||||| |||||| ||| |||    
41618039 ccgtaggaaacttgtcaaacatggaatcattggatctttcgtcaaatatactcactggtgtaattccttcagaattaatcaatctgaacggtattggagt 41618138  T
337 cttggatctttccaataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgt 436  Q
     ||| |||||||  |||| | ||| ||||||| |||||| || ||||| || |||||||||||| | ||||| || ||||||||||||||||  |||||     
41618139 attgaatctttctcataaccatctagtgggagaaatacctcaaggaaaacagttcaatacattttccaatgactcatatgaaggaaacttgggattatgc 41618238  T
437 ggattacccttgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaacttttgcggtgaggagaaatttggatttggatggaaaccag 536  Q
    ||||| ||||||||||| |  |||| |||||||||||||||| | | | || |||||||| ||||  |||| ||||||||||||||||||||||||||||    
41618239 ggatttcccttgtcaaagaaatgtgaacctgaacaacattctccgcttccacccaacaacctttggagtgaagagaaatttggatttggatggaaaccag 41618338  T
537 tggcaattg 545  Q
    |||| ||||    
41618339 tggctattg 41618347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 137; E-Value: 5e-71
Query Start/End: Original strand, 66 - 450
Target Start/End: Original strand, 41713768 - 41714152
Alignment:
66 tggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttgaaggagagattccaaacat 165  Q
    ||||||||||||| |||||||    ||| |||||||||||||| ||||||| || ||||||||| |||||||| |||||||| || ||||||||| |  |    
41713768 tggcgacaaaaggaaacaaaaccccacttgtgaaaattccaaaaatctttgcaagtattgatttttcaagaaataaatttgatggggagattccagatgt 41713867  T
166 tattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaaacttgacatacttggaattt 265  Q
    |||||| ||||||||||   ||| |||||||||||||||  |||||| ||| || ||||| |||||  ||||||| |||||||||| | |||||||||      
41713868 tattggagagcttcatgatctcaaagggcttaacctttcatataacaaactcactggtcacattccccaatccatgggaaacttgataaacttggaatca 41713967  T
266 ttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtcttggatctttccaataatcgtcttgtgg 365  Q
    |||||||| || ||||||||| | || |||  ||||||| |  | ||||| ||| |  ||  ||||||||||||||||||||| ||||| | ||||||||    
41713968 ttggatctctcgtcaaatatgctcactggtcggattcctgtaaagttaaccaatttggactttcttgaagtcttggatctttctaataaccatcttgtgg 41714067  T
366 gagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtggattacccttgtc 450  Q
    ||| |||||| || |||||||| ||||||||||||||||||||||| ||||||||||||||||  ||||||||||| ||||||||    
41714068 gagaaatacctcaaggaaagcagttcaatacatttacaaatgattcctatgaaggaaacttggggttatgtggatttcccttgtc 41714152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 108; E-Value: 1e-53
Query Start/End: Original strand, 540 - 983
Target Start/End: Complemental strand, 42118152 - 42117714
Alignment:
540 caattgacaggcaccattccacaatgtcttactaatttatcatccccttgaagttttgggatttacaaatgaacaagtttcatgacactttgccaaggta 639  Q
    |||||||||| || |||||||||||||||| |||||| ||||  || || ||||||||| |||| |||||||| |  ||| |||  ||||||||||| ||    
42118152 caattgacagacatcattccacaatgtcttgctaattcatcaatcc-ttcaagttttgg-atttgcaaatgaatagattttatggaactttgccaag-ta 42118056  T
640 acttttccaaaagaaagtgcacttaagactccgaatctctatggcaaccaattagaaggtcatattcctaaatccctgtctctctgtaaacggttaatgt 739  Q
    ||||||| | | ||  |||  ||| ||||||  |||||| |||||||||||||||||||||| |||||||||||  | ||||  ||||||    | | ||    
42118055 acttttc-agaggactgtgtgcttcagactctaaatctccatggcaaccaattagaaggtcagattcctaaatctttctctcattgtaaaaacctga-gt 42117958  T
740 ttctaaatcttgggagcaacaacatagaagacaattttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgca 839  Q
    || |||| ||||| |||||||| ||| |||| |  |||||    | |||||||||  | ||||||||| |||||||| |||| | |||||||||||||||    
42117957 ttttaaaccttggcagcaacaaaataaaagaaagatttcccgtctggcttcaaacactacaatatttgcaagtgttggttttacaagacaataagttgca 42117858  T
840 tggtatcattgttaatccaaagctcaagcatccatttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagcctat 939  Q
    ||||||||||  |||||||||| |||||||||||||||||  ||||| ||||||| |||||||| | |||||||||||  |||| ||||||||||| | |    
42117857 tggtatcattcctaatccaaagatcaagcatccatttccaagtttaattattttttatatctcaggaaataactttagctgtccgctaccaaaagcattt 42117758  T
940 ttcaaaaagtttgaagccatgatgaatgttactgagttggaata 983  Q
    || ||||| ||||||||||||| ||| |||||||| ||||||||    
42117757 ttaaaaaaatttgaagccatgaagaaagttactgaattggaata 42117714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 740 - 972
Target Start/End: Original strand, 34240443 - 34240675
Alignment:
740 ttctaaatcttgggagcaacaacatagaagacaattttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgca 839  Q
    ||||||||||| | | |||||| || |||||||| ||||||   | |||||||||  | ||||| ||||||||| || ||||||||||||||||||||||    
34240443 ttctaaatcttcgcaacaacaaaatggaagacaaatttcctgtctggcttcaaactctccaatacttgaaagtgctggttttgcgagacaataagttgca 34240542  T
840 tggtatcattgttaatccaaagctcaagcatccatttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagcctat 939  Q
    ||||  |||||  |||  |||| ||| ||||||||||||   ||||  ||||||||||||||||||||||||||||| |||||| |||||||||||||||    
34240543 tggtcacattgccaatttaaagatcaggcatccatttcctagtttagttatttttgatatctcaagcaataactttactggtccgctaccaaaagcctat 34240642  T
940 ttcaaaaagtttgaagccatgatgaatgttact 972  Q
    || ||| | ||||||||||||| ||| ||||||    
34240643 ttaaaatattttgaagccatgaagaaagttact 34240675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 672 - 961
Target Start/End: Original strand, 34232632 - 34232924
Alignment:
672 gaatctctatggcaaccaattagaaggtcatattcctaaatccctgtctctctgtaaacggttaatgtttctaaatcttgggagcaacaacatagaagac 771  Q
    ||||||| ||||||||||  ||||||||||| | ||||||||  |||| | |||||||  | |   ||||||||| || || |||||||| |||||||||    
34232632 gaatctcaatggcaaccatatagaaggtcatttgcctaaatctttgtcccactgtaaaacgctggagtttctaaacctcggcagcaacaaaatagaagac 34232731  T
772 aattttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgcatggtatcattgttaatccaaagctcaagcatc 871  Q
    || |||||| | | | ||||||| |||||| ||||||||||| |  |||| ||||| |||||||||||||||  |||||  |||  |||| ||||| |||    
34232732 aaatttcctgactggattcaaactttgcaagatttgaaagtgctagttttacgagataataagttgcatggtcacattgccaatttaaagatcaagaatc 34232831  T
872 catttccagatttaactatttttgatatctcaagcaataactttagtggtcctctacca---aaagcctatttcaaaaagtttgaagccatga 961  Q
    |||||||   ||||  |||||||||||||||  | ||||||||||||||||| ||||||   |||| |||||||||||||| |||||||||||    
34232832 catttcccagtttagttatttttgatatctcgggaaataactttagtggtccgctaccaccgaaagactatttcaaaaagtatgaagccatga 34232924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 78; E-Value: 8e-36
Query Start/End: Original strand, 667 - 972
Target Start/End: Complemental strand, 42123766 - 42123461
Alignment:
667 actccgaatctctatggcaaccaattagaaggtcatattcctaaatccctgtctctctgtaaacggttaatgtttctaaatcttgggagcaacaacatag 766  Q
    |||| ||| ||||| |||||||| |||||||| ||| |||| |||||| |||||| |||||||  ||||  ||||||||| || || |||||||| ||||    
42123766 actctgaacctctacggcaaccagttagaaggccattttccaaaatccttgtctcgctgtaaagagttagagtttctaaacctcggtagcaacaaaatag 42123667  T
767 aagacaattttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgcatggtatcattgttaatccaaagctcaa 866  Q
    |||||||||||||| ||| | |||||||  | ||| ||||||||||  || ||||||||||||||||||| ||||||  ||| |  |||  |||| |  |    
42123666 aagacaattttcctgattggtttcaaacacttcaagatttgaaagtactggttttgcgagacaataagtttcatggtcccatcgccaatttaaagattga 42123567  T
867 gcatccatttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagcctatttcaaaaagtttgaagccatgatgaat 966  Q
    || || |||||||   ||||  ||||||||||||||  | ||||||||| |||||  |||||||||||||||||  ||||| | ||||||||||| ||||    
42123566 gcgtctatttccaagcttaatcatttttgatatctctggaaataactttggtggttttctaccaaaagcctattcaaaaaattatgaagccatgaagaat 42123467  T
967 gttact 972  Q
    | ||||    
42123466 gatact 42123461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 110 - 207
Target Start/End: Complemental strand, 41444181 - 41444084
Alignment:
110 atctttgtaattattgatttgtcaagaaacaaatttgaaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttccca 207  Q
    |||||||||| ||||||||| ||| ||||||||||||||||||| ||||||||  |||||||||||||||||||||||||||| || |||||||||||    
41444181 atctttgtaagtattgatttttcaggaaacaaatttgaaggagacattccaaatgttattggtgagcttcatgcaatcataggactcaacctttccca 41444084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 541 - 698
Target Start/End: Original strand, 41713260 - 41713413
Alignment:
541 aattgacaggcaccattccacaatgtcttactaatttatcatccccttgaagttttgggatttacaaatgaacaagtttcatgacactttgccaaggtaa 640  Q
    ||||||| || |||||||||||||||||| ||||||||||||  |||||||||||| |||| ||||||||||||| ||| ||| ||||||||||| ||||    
41713260 aattgactggtaccattccacaatgtcttgctaatttatcat-accttgaagtttt-ggatctacaaatgaacaaattttatggcactttgccaa-gtaa 41713356  T
641 cttttccaaaagaaagtgcacttaagactccgaatctctatggcaaccaattagaagg 698  Q
    ||||| |||| || ||||  ||| | ||||  ||||||||||||||| ||||||||||    
41713357 ctttt-caaaggacagtgagcttcatactctaaatctctatggcaacaaattagaagg 41713413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 541 - 646
Target Start/End: Original strand, 41571722 - 41571824
Alignment:
541 aattgacaggcaccattccacaatgtcttactaatttatcatccccttgaagttttgggatttacaaatgaacaagtttcatgacactttgccaaggtaa 640  Q
    |||||||||||||||||||||| |||||| | || ||||||| ||||| ||||||| |||||||||||||||||| ||| ||| |||||| |||| ||||    
41571722 aattgacaggcaccattccacattgtcttgcaaacttatcat-cccttcaagtttt-ggatttacaaatgaacaaattttatggcactttaccaa-gtaa 41571818  T
641 cttttc 646  Q
    ||||||    
41571819 cttttc 41571824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 893 - 974
Target Start/End: Original strand, 41713612 - 41713693
Alignment:
893 ttgatatctcaagcaataactttagtggtcctctaccaaaagcctatttcaaaaagtttgaagccatgatgaatgttactga 974  Q
    ||||||||||  ||||| |||| |||||||| ||||||||||||||||| ||||| | | || |||||| ||||||||||||    
41713612 ttgatatctcgggcaatgacttcagtggtccgctaccaaaagcctatttaaaaaattatcaaaccatgaagaatgttactga 41713693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 863 - 938
Target Start/End: Original strand, 41572040 - 41572115
Alignment:
863 tcaagcatccatttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagccta 938  Q
    ||||||||||||||||   ||||| |||||||||||| |||  ||||||||| ||||| || ||||||||||||||    
41572040 tcaagcatccatttcctagtttaattatttttgatatttcatccaataacttcagtggcccactaccaaaagccta 41572115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 863 - 938
Target Start/End: Original strand, 41617679 - 41617754
Alignment:
863 tcaagcatccatttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagccta 938  Q
    ||||||||||||||||   ||||| |||||||||||| |||  ||||||||| ||||| || ||||||||||||||    
41617679 tcaagcatccatttcctagtttaattatttttgatatttcatccaataacttcagtggcccactaccaaaagccta 41617754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 509 - 545
Target Start/End: Original strand, 41714176 - 41714212
Alignment:
509 gagaaatttggatttggatggaaaccagtggcaattg 545  Q
    |||||||||||||||||||||||| ||||||||||||    
41714176 gagaaatttggatttggatggaaagcagtggcaattg 41714212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 554 - 633
Target Start/End: Original strand, 34240261 - 34240338
Alignment:
554 cattccacaatgtcttactaatttatcatccccttgaagttttgggatttacaaatgaacaagtttcatgacactttgcc 633  Q
    |||||||||||||||| |||||||| ||| ||||| || |||| |||| ||||||||||||| ||| ||| |||||||||    
34240261 cattccacaatgtcttgctaatttaccat-cccttcaaatttt-ggatctacaaatgaacaacttttatggcactttgcc 34240338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 540 - 979
Target Start/End: Complemental strand, 12248851 - 12248416
Alignment:
540 caattgacaggcaccattccacaatgtcttactaatttatcatccccttgaagttttgggatttacaaatgaacaagtttcatgacactttgccaaggta 639  Q
    ||||||||||| | |||||||||||||||| || |||||||||||| || ||||||||  || ||||||||||||| ||||||| |||||||||||| ||    
12248851 caattgacaggtatcattccacaatgtcttgctgatttatcatccc-ttcaagttttga-atctacaaatgaacaaatttcatggcactttgccaag-ta 12248755  T
640 acttttccaaaagaa-agtgcacttaagactccgaatctctatggcaaccaattagaaggtcatattcctaaatccctgtctctctgtaaacggttaatg 738  Q
    |||| ||  |||||  ||||||||| |||||| |||||| |||||||||||||||||||| |||||||||| |||| |||||||||||||| |||| | |    
12248754 acttctc--aaagatgagtgcacttgagactctgaatctttatggcaaccaattagaaggccatattcctagatccttgtctctctgtaaagggttgaag 12248657  T
739 tttctaaatcttgggagcaacaacatagaagacaattttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgc 838  Q
    |||||||| || || |||||||| ||||||||| | |||||| ||| |||||||||  ||||| |||||||||| |||||  ||||||||||||||||||    
12248656 tttctaaacctcggcagcaacaaaatagaagacgagtttcctgattggcttcaaacactgcaagatttgaaagttttgctgctgcgagacaataagttgc 12248557  T
839 atggtatcattgttaatccaaagctcaagcatccatttccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagccta 938  Q
    |||||||||||||||||| |||    |||||||||||||||  |||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||    
12248556 atggtatcattgttaatctaaatacaaagcatccatttccaagtttaactatttttgatatctcaggcaataactttagtggtccgctaccaaatgccta 12248457  T
939 tttcaaaaagtttgaagccatgatgaatgttactgagttgg 979  Q
    |||  |||||||||||||||||| ||||||| |||| ||||    
12248456 ttttgaaaagtttgaagccatgaagaatgttgctgaattgg 12248416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 200; E-Value: 1e-108
Query Start/End: Original strand, 40 - 545
Target Start/End: Original strand, 11994584 - 11995093
Alignment:
40 tgcaccctactatgattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaac 139  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||| |  ||| ||||||||||||||||| ||||||||||||||||||||||||    
11994584 tgcaccctactatgattctgtgattgtggcgtcaaaagggaacaaaatgacatgggttaaaattccaaacatcttagtaattattgatttgtcaagaaac 11994683  T
140 aaatttgaaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatcca 239  Q
    |||||||||||||||||||||||  |||||| ||||||||| ||| | ||||||||||||||||||||||||||||| |  |||| |||||| |||||||    
11994684 aaatttgaaggagagattccaaatgttattgatgagcttcaagcacttatagggcttaacctttcccataacagactcattggtcctattcccaaatcca 11994783  T
240 taggaaacttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtctt 339  Q
    | |||||||||||| |||||||||   ||||||| || ||||||||| | || | |||||||||     ||||||| ||| |   |  ||||| ||| ||    
11994784 tgggaaacttgacaaacttggaatggctggatctctcatcaaatatgctcactgatgtgattccagcaaaattaaccaatttgggctttcttgcagtttt 11994883  T
340 ggatctttccaataatcgtcttgtgggagtaataccgcagggaaagcaatt-caatacatttacaaatgattcttatgaaggaaacttggatttatgtgg 438  Q
     ||  |||||||||| | ||| ||||||| |||||| |  ||||| || || | | |||||| |||||||||| |||| |||||||||||| |||||||     
11994884 agacttttccaataaccatctagtgggagaaatacctcgaggaaaacagttccgagacattttcaaatgattcatatgtaggaaacttggagttatgtga 11994983  T
439 attacccttgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaa---cttttgcggtgaggagaaatttggatttggatggaaacca 535  Q
    ||| ||||||||||| | ||| ||||||||||||| |||| |||||||| |||||||   |||||   |||| |||||||||||||||||||||||||||    
11994984 atttcccttgtcaaagaagtgcggacctgaacaacgttctccaccttcacccaacaacagcttttcgagtgaagagaaatttggatttggatggaaacca 11995083  T
536 gtggcaattg 545  Q
    ||||||||||    
11995084 gtggcaattg 11995093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 40 - 545
Target Start/End: Complemental strand, 12248345 - 12247837
Alignment:
40 tgcaccctactatgattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaac 139  Q
    ||||||||||||||||||||||||||||||  |||||||||||||||||| |  ||| ||||||||||||||||| ||||||||||||||||||||||||    
12248345 tgcaccctactatgattctgtgattgtggcatcaaaagggaacaaaatgacatgggttaaaattccaaacatcttagtaattattgatttgtcaagaaac 12248246  T
140 aaatttgaaggagagattccaaacattattggtgagcttcatgcaatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatcca 239  Q
    |||||||||||||||||||||||  |||||| ||||||||| ||| | ||||||||||||||||||||||||||||| |  |||| |||||| |||||||    
12248245 aaatttgaaggagagattccaaatgttattgatgagcttcaagcacttatagggcttaacctttcccataacagactcattggtcctattcccaaatcca 12248146  T
240 taggaaacttgacatacttggaatttttggatctttcctcaaatatgttaaccggtgtgattcctttggaattaactaatcttaacggtcttgaagtctt 339  Q
    | |||||||||||| |||||||||   ||||||| || ||||||||| | || | |||||||||     ||||||| ||| |   |  ||||| ||| ||    
12248145 tgggaaacttgacaaacttggaatggctggatctctcatcaaatatgctcactgatgtgattccagcaaaattaaccaatttgggctttcttgcagtttt 12248046  T
340 ggatctttccaataatcgtcttgtgggagtaataccgcagggaaagcaattcaatacatttacaaatgattcttatgaaggaaacttggatttatgtgga 439  Q
     ||  |||||||||| | ||| ||||||| |||||| |  ||||| || ||| | |||||| |||||||||| |||| |||||||||||| |||||||||    
12248045 agacttttccaataaccatctagtgggagaaatacctcgaggaaaacagttcgagacattttcaaatgattcatatgtaggaaacttggagttatgtgga 12247946  T
440 ttacccttgtcaaaaatgtgtggacctgaacaacattctgcaccttca---gccaacaacttttgcggtgaggagaaatttggatttggatggaaaccag 536  Q
    || ||||||||||| | |||||||||||||||| |||||  |||||||     ||||| ||||||  | || | |||||||||||||||||||||||| |    
12247945 tttcccttgtcaaagaagtgtggacctgaacaatattctcaaccttcacttaacaacagcttttggagcgacgcgaaatttggatttggatggaaaccgg 12247846  T
537 tggcaattg 545  Q
    |||||||||    
12247845 tggcaattg 12247837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 172; E-Value: 7e-92
Query Start/End: Original strand, 603 - 994
Target Start/End: Original strand, 11994139 - 11994528
Alignment:
603 tacaaatgaacaagtttcatgacactttgccaaggtaacttttccaaaagaaagtgcacttaagactccgaatctctatggcaaccaattagaaggtcat 702  Q
    ||||||||||||  | ||||| |||||||||||| |||||| || ||| || ||||||||| |||||| ||||||||||||||||||||||||||| |||    
11994139 tacaaatgaacacatgtcatggcactttgccaag-taacttctc-aaaggagagtgcacttgagactctgaatctctatggcaaccaattagaaggccat 11994236  T
703 attcctaaatccctgtctctctgtaaacggttaatgtttctaaatcttgggagcaacaacatagaagacaattttcctcattagcttcaaaccttgcaat 802  Q
    ||||||| |||| |  ||||||||||| |||| | ||||||||| || || |||||||| ||||||||| | |||||| ||| |||||||||  |||||     
11994237 attcctagatccttaactctctgtaaagggttgaagtttctaaacctcggcagcaacaaaatagaagacgagtttcctgattggcttcaaacactgcaag 11994336  T
803 atttgaaagtgttgcttttgcgagacaataagttgcatggtatcattgttaatccaaagctcaagcatccatttccagatttaactatttttgatatctc 902  Q
    |||||||||| |||||  ||||||||||||||||||||| |||||||||||||| |||    |||||||||||||||  ||||||||||||||||||||     
11994337 atttgaaagttttgctgctgcgagacaataagttgcatgatatcattgttaatctaaatacaaagcatccatttccaagtttaactatttttgatatcta 11994436  T
903 aagcaataactttagtggtcctctaccaaaagcctatttcaaaaagtttgaagccatgatgaatgttactgagttggaatatatgtggaata 994  Q
    | ||||||||||||||||||| |||||||| ||||||||  |||||||||||||||||| ||||||| |||| |||| ||| ||| ||||||    
11994437 aggcaataactttagtggtccgctaccaaatgcctattttgaaaagtttgaagccatgaagaatgttgctgaattggtatacatgaggaata 11994528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 88; E-Value: 9e-42
Query Start/End: Original strand, 53 - 245
Target Start/End: Original strand, 32682113 - 32682311
Alignment:
53 gattctgtgattgtggcgacaaaagggaacaaaatgaaactggtgaaaattccaaacatctttgtaattattgatttgtcaagaaacaaatttgaaggag 152  Q
    |||||||||| | ||| ||||||||||| |||||||| ||| |||||||||||||  | |||||||| |||||||||||||||||||| |||||||||||    
32682113 gattctgtgactatggggacaaaagggagcaaaatgacactagtgaaaattccaagaaactttgtaagtattgatttgtcaagaaacagatttgaaggag 32682212  T
153 agattccaaacattattggtgagcttcatgc------aatcatagggcttaacctttcccataacagacttacaggtcatattccgaaatccataggaa 245  Q
    ||||||||||   |||||| |||||||||||      ||||| ||||||||||||||||||||||||||| || | |||||||||  ||||||| ||||    
32682213 agattccaaatgctattggggagcttcatgcactcagaatcagagggcttaacctttcccataacagactcaccgatcatattccccaatccatgggaa 32682311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 676 - 972
Target Start/End: Original strand, 32681747 - 32682043
Alignment:
676 ctctatggcaaccaattagaaggtcatattcctaaatccctgtctctctgtaaacggttaatgtttctaaatcttgggagcaacaacatagaagacaatt 775  Q
    |||||||||||||| || ||||| ||| |||| |||||| |||||  |||||||  |||   ||||||||| || || |||||||| ||||| |||||||    
32681747 ctctatggcaaccacttggaaggccattttccgaaatccttgtctggctgtaaaaagttggagtttctaaacctcggaagcaacaaaatagacgacaatt 32681846  T
776 ttcctcattagcttcaaaccttgcaatatttgaaagtgttgcttttgcgagacaataagttgcatggtatcattgttaatccaaagctcaagcatccatt 875  Q
    | ||  ||| |||||| ||  ||||| |||||||||| ||| ||||||| ||||| ||||||||||||  |||||| |||  ||||  | | |||| |||    
32681847 tcccatattggcttcatacaatgcaagatttgaaagtattggttttgcgtgacaacaagttgcatggtcccattgtcaatttaaagaacgaacatctatt 32681946  T
876 tccagatttaactatttttgatatctcaagcaataactttagtggtcctctaccaaaagcctatttcaaaaagtttgaagccatgatgaatgttact 972  Q
    |||    ||||  ||||||||||||||  | || ||||| ||||||  | || ||||||| ||||| ||    ||||||||||||| ||||||||||    
32681947 tcctagcttaatcatttttgatatctctggaaacaacttcagtggttttatatcaaaagcttatttaaatttttttgaagccatgaagaatgttact 32682043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 403 - 545
Target Start/End: Original strand, 9423281 - 9423424
Alignment:
403 aaatgattcttatgaaggaaacttggatttatgtggattacccttgtcaaaaatgtgtggacctgaacaacattctgcaccttcagccaacaactt---t 499  Q
    |||||||| |||||||||||||| ||  |||||  |||| ||||||| ||  |  ||||||||| ||| | ||||| || ||||| ||||||| ||   |    
9423281 aaatgatttttatgaaggaaactgggggttatg--gatttcccttgtaaatgaaatgtggacctaaacgaaattctacaacttcacccaacaaattatat 9423378  T
500 tgcggtgaggagaaatttggatttggatggaaaccagtggcaattg 545  Q
    |||  ||| |||||||||||||||||||||||| ||||||||||||    
9423379 tgcaatgaagagaaatttggatttggatggaaatcagtggcaattg 9423424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 314268 times since January 2019
Visitors: 446