View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-26 (Length: 105)

Name: R108-tnk148-26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-26
R108-tnk148-26
[»] chr5 (2 HSPs)
chr5 (19-105)||(31389089-31389175)
chr5 (19-103)||(31496368-31496455)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 8e-40; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 8e-40
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 31389175 - 31389089
Alignment:
19 ccaattatacccatcatcatgattcacccttctcaaagaatgactttgttggctaacattcctatgatcagattgaaattcatttat 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
31389175 ccaattatacccatcatcatgattcacccttctcaaagaatgactttgttggctaacattcctatgatgagattgaaattcatttat 31389089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 31496455 - 31496368
Alignment:
19 ccaattatacccatcatcatgattcacccttctca---aagaatgactttgttggctaacattcctatgatcagattgaaattcattt 103  Q
    |||||||||||||||||||||||||| |||||| |   | || | | ||||||||| | |||| |||| |||||||||||||||||||    
31496455 ccaattatacccatcatcatgattcatccttcttactgacgacttattttgttggcgaccattactataatcagattgaaattcattt 31496368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105771 times since January 2019
Visitors: 1319