View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-28 (Length: 734)

Name: R108-tnk148-28
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-28
R108-tnk148-28
[»] chr6 (2 HSPs)
chr6 (1-312)||(35093682-35093993)
chr6 (317-549)||(35092942-35093173)


Alignment Details
Target: chr6 (Bit Score: 300; Significance: 1e-168; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 35093682 - 35093993
Alignment:
1 gtcttctttgttatcctcccgtgctgtaaatactcaggtgacgcgtatataaccattatttcacgagcaacatcctggtttatcactggtactaatccgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
35093682 gtcttctttgttatcctcccgtgctgtaaatactcaggtgacgcgtatataaccattatttcatgagcaacatcctggtttatcactggtactaatccgt 35093781  T
101 agtcggttagtataggctctaatgactcgttcaatagaacatttgaggatttaagatgaccatgaggcgcaaccaagttcggcaactcctcgtatagata 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||    
35093782 agtcggttagtataggctctaatgactcgttcaatagaacatttgaggatttaagatgaccatgaggcgcaatcaagttcggcaactccttgtatagata 35093881  T
201 ttcaatccctttcgctacacctttcactatcttcaacctgcttggccagtcaaggctttcctgtcctatagaatggtatcctgtattagatgtaaaagtt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35093882 ttcaatccctttcgctacacctttcactatcttcaacctgcttggccagtcaaggctttcctgtcctatagaatggtatcctgtattagatgtaaaagtt 35093981  T
301 agttacactagt 312  Q
    ||||||||||||    
35093982 agttacactagt 35093993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 175; E-Value: 8e-94
Query Start/End: Original strand, 317 - 549
Target Start/End: Original strand, 35092942 - 35093173
Alignment:
317 atatatacgttaataagagcaccattagttggcgatgttcttaaac--aaaaaagaaggtatcgattcaacctcaatcaagtgcacttcaatatctcaaa 414  Q
    ||||||||||||||||||||||||||| |||||||||||||||||   |||||| |||||||||||||||||||||||||||||||||||||||||||||    
35092942 atatatacgttaataagagcaccattaattggcgatgttcttaaaacaaaaaaaaaaggtatcgattcaacctcaatcaagtgcacttcaatatctcaaa 35093041  T
415 ttcattatttacattaacctcttgttctcctcaactctccaatatactaacctcacctctttaattacactgggnaattaaataaaacattgaaactaac 514  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||     || ||||||||||||||||||    
35093042 ttcattatttacattaagctcttgttctcctcaactctccaatatactaacctcacctctttaattacactggg-----aattaaaacattgaaactaac 35093136  T
515 ccagcaacgtaatagagata--tgcatagatatgaac 549  Q
    ||||||||||||||||||||  |||||||||||||||    
35093137 ccagcaacgtaatagagatatttgcatagatatgaac 35093173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 309260 times since January 2019
Visitors: 444