View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-3 (Length: 960)

Name: R108-tnk148-3
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-3
R108-tnk148-3
[»] chr3 (3 HSPs)
chr3 (163-960)||(42638635-42639430)
chr3 (163-887)||(42631491-42632216)
chr3 (1-169)||(42639426-42639594)


Alignment Details
Target: chr3 (Bit Score: 758; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 758; E-Value: 0
Query Start/End: Original strand, 163 - 960
Target Start/End: Original strand, 42638635 - 42639430
Alignment:
163 caattgtagaacagtttgagaatctccacacactcggttgcaacatttgagtacaacatatttgtacactttgttccatcgtcacgaacaactttactgg 262  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
42638635 caattgtagaacagtttgagaatctccacacactcggttgcaacatttgagtacaacatatttgtacactttgttccatcatcacgaacaactttactgg 42638734  T
263 ctggtaaaattgtcagagacaaaacagtccctagtgacataaaagccataaaaccaatataagtgccatcgtttaaccgtagcagcttgatcaccacgat 362  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
42638735 ctggtaaaattgtcagagacaaaacagtccctagtgacataaaagccataaaaccaatataagtgccatcgtt-aaccgtagcagcttgatcaccacgat 42638833  T
363 tgtaattaagaataaaaggaattaaaccaccaataaccccacccatattgaaaatactccagaaaattgaaatgtaagttcctttccgattcatgggtgg 462  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
42638834 tgtaattaagaataaaaggaattaaaccaccaataaccccacccatattgaaaatactccagaaaattgaaatgtaagttcctttacgattcatgggtgg 42638933  T
463 ataagatgtcataatagcaccttgggcagaccataatagtccagctccgatgccgagaacagcgccggaaactacagcaaaagcttgatgttgtttatga 562  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42638934 ataagatgtcataatagcaccttgggcagaccataatagtccagctccgatgccgagaacagcgccggaaactacagcaaaagcttgatgttgtttatga 42639033  T
563 ttgtagtagaggaatgaaccggtgtaaaggacataggaggaacaacctgcgaaaagagttaagtggggtccgaggatgttgtagatgccaccacctaggn 662  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
42639034 ttgtagtagaggaatgaaccggtgtaaaggacataggaggaacaacctgcgaaaagagttaagtggggtccgaggatgttgtagatgccaccacctagg- 42639132  T
663 attccgaaaattgtgaagcttgtgtaaagtgcggttaaggcgttgttcgaagctgttgcattgacttgaccaccaccacccattcctgaaagagcattga 762  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
42639133 attccgaaaattgtgaagcttgtgtaaagtgcggttaaggcgttgttagaagctgttgcattgacttgaccaccaccacccattcctgaaagagcattga 42639232  T
763 acatgcctggacaacaaaaacaaaccaatccaataaggatgatttgtgaaggaggcgaattgtatcggacaagtgatgaagtttttgtggtttccggtgg 862  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||    
42639233 acatgcctggacaacaaaaacaaaccaatccaataaggatgatttgtgaaagaggcgaattgtatcggacaagtgatgaagtttttgtggttttcggtgg 42639332  T
863 ttgagtggctgattcttcatattcaacgacaccacccattgggaaattgtgaaagagtgaagatggtgaaagagagattcagaattggagatgaagaa 960  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
42639333 ttgagtggctgattcttcatattcaacgacaccacccattgggaaattgtgaaagagtgaagatggtggaagagagattcagaattggagatgaagaa 42639430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 163 - 887
Target Start/End: Original strand, 42631491 - 42632216
Alignment:
163 caattgtagaacagtttgagaatctccacacactcggttgcaacatttgagtacaacatatttgtacactttgttccatcgtcacgaacaactttactgg 262  Q
    ||||| ||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |    
42631491 caattatagaacaatttaagaatctccacacactcagttgcaacatttgagtacaacatatttgtacactttgttccatcatcacgaacaactttactag 42631590  T
263 ctggtaaaattgtcagagacaaaacagtccctagtgacataaaagccataaaaccaatataagtgccatcgtttaaccgtagcagcttgatcaccacgat 362  Q
    |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||    
42631591 ctggtaaaatagttagagacaaaacagtccctagtgacataaaagccataaaaccaatataagttccatcatt-aaccgtagcagcttgatcaccacgat 42631689  T
363 tgtaattaagaataaaaggaattaaaccaccaataaccccacccatattgaaaatactccagaaaattgaaatgtaagttcctttccgattcatgggtgg 462  Q
    |||||||||||||||||||||| || ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||    
42631690 tgtaattaagaataaaaggaatcaacccaccaataacaccacccatgttgaaaatactccagaaaattgaaatgtaagttcctttacggttcatgggtgg 42631789  T
463 ataagatgtcataatagcaccttgggcagaccataatagtccagctccgatgccgagaacagcgccggaaactacagcaaaagcttgatgttgtttatga 562  Q
    |||||||||||||||||||||||| |||| ||||||||| || ||||||||||||||||  || |||| ||||| |||||||||||||||||||||||||    
42631790 ataagatgtcataatagcaccttgtgcagcccataatagacctgctccgatgccgagaagggcaccggcaactatagcaaaagcttgatgttgtttatga 42631889  T
563 ttgtagtagaggaatgaaccggtgtaaaggacataggaggaacaacctgcgaaaagagttaagtggggtccgaggatgttgtagatgccaccacctaggn 662  Q
    || ||||| ||||| ||||| | ||| || ||||| |  |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||     
42631890 ttatagtaaaggaaagaaccagcgtagagtacataagttgaacaacctgcgaaaagagttaagtgaggtccgaggatgttgtagatgccaccacctagg- 42631988  T
663 attccgaaaattgtgaagcttgtgtaaagtgcggttaaggcgttgttcgaagctgttgcattgacttgaccaccaccacccattcctgaaagagcattga 762  Q
    || || || | ||  ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
42631989 ataccaaacactgcaaaggttgtgtaaagtgcggttaaggcgttgttagaagctgttgcattgacttgaccaccaccacccattcctgaaagagcgttga 42632088  T
763 acatgcctggacaacaaaaacaaaccaatccaataaggatgatttgtgaaggaggcgaattgtatcggacaa---gtgatgaagtttttgtggtttccgg 859  Q
    ||||||||||||||||||||||||| || ||||||||||| ||||||||| |||| |||||||||| || ||   |||||||||||||||| ||||| ||    
42632089 acatgcctggacaacaaaaacaaactaagccaataaggattatttgtgaaagaggtgaattgtatctgaaaaggtgtgatgaagtttttgttgtttctgg 42632188  T
860 tggttgagtggctgattcttcatattca 887  Q
    || ||||||  |||||||| ||| ||||    
42632189 tgtttgagttcctgattctacattttca 42632216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 134; E-Value: 3e-69
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 42639426 - 42639594
Alignment:
1 aagaatgaaaagcgaaagaaacaacaatttatggagttggagattgagatttgaccaccataatgtggaaaagtttgcagtaaatgcaattaaaaacatg 100  Q
    |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42639426 aagaatgaaaagagagagaaacaacaatttatggagttggagattgagatttgaccaccataatgtggaaaagtttgcagtaaatgcaattaaaaacatg 42639525  T
101 acaaatttggagttaagnnnnnnnnnacaagcgaaacattgtagctacatgcaacgttgtttcaattgt 169  Q
    |||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||    
42639526 acaaatttggagttaagtttttttttacaagcgaaacattgtagctacatgcaacgttgtttcaattgt 42639594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110555 times since January 2019
Visitors: 1335