View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-30 (Length: 508)

Name: R108-tnk148-30
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-30
R108-tnk148-30
[»] chr3 (2 HSPs)
chr3 (197-508)||(41551196-41551508)
chr3 (1-195)||(41550879-41551073)


Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 197 - 508
Target Start/End: Complemental strand, 41551508 - 41551196
Alignment:
197 ttctttttgatggggacataaatagggaacaatctagaatattcattagctcttgaaaacggctatgtacacaaaatcatggtagcatgggttttaaaag 296  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41551508 ttctttttgatggggacataa-tagggaacaatctagaatattcattagctcttgaaaacggctatgtacacaaaatcatggtagcatgggttttaaaag 41551410  T
297 tttgaaggctttaactatacaatgcttggaaaacaagc---ctgcaagntggttcacaaattctggtagcttaatcacttgcattggtcataacccaaac 393  Q
    ||||||||||||||||||||||||||||||||||||||   ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
41551409 tttgaaggctttaactatacaatgcttggaaaacaagcctgctgcaagtt-gttcacaaattctggtagcttaatcacttgcattggtcataacccaaac 41551311  T
394 tacgttttgcgtagcctaccgtagtatatgnagtgcaaggtttgttgtcctaagagtg-naaaatggtgtatnggntcgcgngaaaacataanggtttag 492  Q
    |||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||  |||||||||||| || ||| | |||||||||| |||||||    
41551310 tacgttttgcgtag-ctaccgtagtatatggagtgcaaagtttgttgtcctaagagtgtaaaaatggtgtattggttcgtgtgaaaacataaaggtttag 41551212  T
493 accaaaaggggcgtta 508  Q
    ||||||| ||||||||    
41551211 accaaaaagggcgtta 41551196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 41551073 - 41550879
Alignment:
1 ttgcactgcacatttcggtcatggaagataacattgtttggtggttagaaaaggatgcaatttattcggtttgaagtccacattatttttgcattgaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||  |||||||||||||||||||||    
41551073 ttgcactgcacatttcggtcatggaagataacattgtttggaggttagaaaaagatgcaatttattcggtttgaagtgaacattatttttgcattgaaaa 41550974  T
101 tgacagtgtttcggaccaactaaagtatagatggnagttggaatacaatttggctatccaaaattctgccgcaagnaaaaaattcaatttggcga 195  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
41550973 tgacagtgtttcggaccaactaaagtatagatggtagttggaatacaatttggctatccaaaattctgccgtaagtaaaaaattcaatttggcga 41550879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106153 times since January 2019
Visitors: 1319