View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk148-32 (Length: 122)
Name: R108-tnk148-32
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-tnk148-32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 34668245 - 34668341
Alignment:
Q |
1 |
ctgataccacattaagtatgattatttgattatctttcttgttcataacttttagcagtttatattgatgtacaattctgatttgtagacaattgta |
97 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| || |||||||||||||||| ||||||||||||||||||| |
|
|
T |
34668245 |
ctgataccacattaagtatgattatttgattatctttcttgttcaaaactgttagcaattaatattgatgtacaattttgatttgtagacaattgta |
34668341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 105811 times since January 2019
Visitors: 1319