View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-34 (Length: 393)

Name: R108-tnk148-34
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-34
R108-tnk148-34
[»] chr4 (2 HSPs)
chr4 (96-393)||(31811221-31811518)
chr4 (1-101)||(31811514-31811614)


Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 96 - 393
Target Start/End: Original strand, 31811221 - 31811518
Alignment:
96 gaattcaggtacccaacattgatgaacctaagaaatgttactacataaagttgtataggaacaaaacaaaacgattgttgtacaagcaaagctatgattg 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31811221 gaattcaggtacccaacattgatgaacctaagaaatgttactacataaagttgtataggaacaaaacaaaacgattgttgtacaagcaaagctatgattg 31811320  T
196 attccagctacataaaataaaacagtaaaattggttcatcatatttttcacaaaattaaacagttttcagcgtagtacaagacgtgacagttcgttttgt 295  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31811321 attccagctgcataaaataaaacagtaaaattggttcatcatatttttcacaaaattaaacagttttcagcgtagtacaagacgtgacagttcgttttgt 31811420  T
296 tattggcgaaaagaatagcaaattgagcantggtgggttcttctcccacttgctgctagtgtcaagttgcatcaaatatttgatttgtatgaacatag 393  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
31811421 tattggcgaaaagaatagcaaattgagcaatggtgggttcttctcccacttgctgctagtgtcaagttgcatcaaatatttggtttgtatgaacatag 31811518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 31811514 - 31811614
Alignment:
1 catagatagatcaagagaacaagtaccattagcaatgtagaccctactgtaaaatgtttcttcatgttctcagtcaaacataacaccatccgtaagaatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31811514 catagatagatcaagagaacaagtaccattagcaatgtagaccctactgtaaaatgtttcttcatgttctcagtcaaacataacaccatccgtaagaatt 31811613  T
101 c 101  Q
    |    
31811614 c 31811614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203005 times since January 2019
Visitors: 1517