View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-40 (Length: 174)

Name: R108-tnk148-40
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-40
R108-tnk148-40
[»] chr7 (1 HSPs)
chr7 (1-174)||(47465186-47465359)


Alignment Details
Target: chr7 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 47465186 - 47465359
Alignment:
1 agaacttgataacttatgcaatgatcaagaaatattgaagcttgagccaaagattatccttgctggttgtaggataaaccgttgattttttaaaatacta 100  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
47465186 agaacttgataaattatgcaatgatcaagaaatattgaagcttgagccaaagattatccttgctggttgtaggataaaccgttgattttttaaaatgcta 47465285  T
101 ctaaattccgtctgagtcaacaattattggcagggtagttgttgtataactaaattctgtttgtatcaattaat 174  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
47465286 ctaaattccgtttgagtcaacaattattggcagggtagttgttgtataactaaattctgtttgtatgaattaat 47465359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176008 times since January 2019
Visitors: 1577