View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk148-49 (Length: 116)
Name: R108-tnk148-49
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk148-49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 3e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 3e-59
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 2669698 - 2669812
Alignment:
| Q |
1 |
ccagataaaatatttgtttgggtggcaaatagagacacccctcttgaaaattctaatggaactctcaagattcaagatggtggaaaattggttcttttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2669698 |
ccagataaaatatttgtttgggtggcaaatagagacacccctcttgaaaattctaatggaactctcaagattcaagatggtggaaaattggttcttttca |
2669797 |
T |
|
| Q |
101 |
accaaacagataatc |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2669798 |
accaaacagataatc |
2669812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 308630 times since January 2019
Visitors: 442