View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-49 (Length: 116)

Name: R108-tnk148-49
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-49
R108-tnk148-49
[»] chr2 (1 HSPs)
chr2 (1-115)||(2669698-2669812)


Alignment Details
Target: chr2 (Bit Score: 115; Significance: 3e-59; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 115; E-Value: 3e-59
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 2669698 - 2669812
Alignment:
1 ccagataaaatatttgtttgggtggcaaatagagacacccctcttgaaaattctaatggaactctcaagattcaagatggtggaaaattggttcttttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2669698 ccagataaaatatttgtttgggtggcaaatagagacacccctcttgaaaattctaatggaactctcaagattcaagatggtggaaaattggttcttttca 2669797  T
101 accaaacagataatc 115  Q
    |||||||||||||||    
2669798 accaaacagataatc 2669812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 308630 times since January 2019
Visitors: 442