View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-5 (Length: 971)

Name: R108-tnk148-5
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-5
R108-tnk148-5
[»] chr6 (3 HSPs)
chr6 (468-971)||(5302799-5303292)
chr6 (13-120)||(5302684-5302791)
chr6 (174-256)||(5303750-5303832)
[»] chr3 (4 HSPs)
chr3 (468-857)||(54728522-54728899)
chr3 (13-146)||(54727996-54728129)
chr3 (877-967)||(54728140-54728230)
chr3 (174-256)||(54729359-54729441)
[»] chr4 (1 HSPs)
chr4 (480-555)||(26588524-26588599)


Alignment Details
Target: chr6 (Bit Score: 331; Significance: 0; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 468 - 971
Target Start/End: Complemental strand, 5303292 - 5302799
Alignment:
468 aagaaagagatctgatggctgaaggtctgatcaggttggtgtct----gcccatgcaagccaacagatttgtaccagagctacaaacacctaaattttat 563  Q
    |||||||||||||||||||| |||||||||||||||||||||||    |||||||||||| ||||||||| |||||  ||||||||||||||||||||||    
5303292 aagaaagagatctgatggctaaaggtctgatcaggttggtgtctatctgcccatgcaagcgaacagatttataccaatgctacaaacacctaaattttat 5303193  T
564 accactcatatatagtttaatgttgtattcatcgatatttgtcgaggatgactctgatgaagtaattttcttattgctaaattgaagccttaaaggtttc 663  Q
    ||||||||||    ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||||     
5303192 accactcata----gttta-tgttgtattgatcgatatttgtcgaggatgactctgatgaagtaattttcttattgctaaattgatgtcttaaatgtttt 5303098  T
664 ctcccctttttgggtgcggggaaataaaatatttggacttacatacatctcatcatttttctttattcagccaccatctaattgcttcacatgtccaaac 763  Q
    || | |||||||| ||| ||    ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5303097 cttctctttttggttgctgg----taatatatttg-acttacatacatctcatcatttttctttattcagccaccatctaattgcttcacatgtccaaac 5303003  T
764 caaatcatctaagtccaaattcattagtattaattttctgggtgaagttgagaaaacttttagttcaacccacctaaattgaaattcaactgtannnnnn 863  Q
    ||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
5303002 caaatcatctaagtccaaattcattagt----attttctgggtgaagttgagaaaacttttagttcaacccacctaaattgaaattcaactgtatttttt 5302907  T
864 nattaagaggtttttagacctatcgttgcctcagtattaacttcatctttctccagttgattatctcttcccacacccgcagcagcactatagccattca 963  Q
     | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
5302906 tagtaagaggtttttagacctatcgttgcctcagtattagcttcatctttctccagttgattatctcttcccacacccacagcagcactatagccattca 5302807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 13 - 120
Target Start/End: Complemental strand, 5302791 - 5302684
Alignment:
13 caaggacaagcagaacaagtgaagcagtagttttttgtcatagtgtgcaatatatgaatgaatattatcaagatctatattaattaacgtggccttgatg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5302791 caaggacaagcagaacaagtgaagcagtagttttttgtcatagtgtgcaatatatgaatgaatattatcaagatctatattaattaacgtggccttgatg 5302692  T
113 gtcataga 120  Q
    || |||||    
5302691 gttataga 5302684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 174 - 256
Target Start/End: Complemental strand, 5303832 - 5303750
Alignment:
174 aattgttggaattttgatgctactaaggaggtttaaggctgttgcttgattgataatcttgtataagctccaacattccttga 256  Q
    ||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||| ||||||||||||    
5303832 aattgttggaattttgatgctactaaggaggtttacggctgtttcttgattggtaatcttgtataagctctaacattccttga 5303750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 468 - 857
Target Start/End: Complemental strand, 54728899 - 54728522
Alignment:
468 aagaaagagatctgatggctgaaggtctgatcaggttggtgtct----gcccatgcaagccaacagatttgtaccagagctacaaacacctaaattttat 563  Q
    ||||||||| |||||||||| |||||||||||||||||||||||    |||||||||||||||||||||| |||||||||||||||||||||||||||||    
54728899 aagaaagagctctgatggctaaaggtctgatcaggttggtgtctatctgcccatgcaagccaacagatttataccagagctacaaacacctaaattttat 54728800  T
564 accactcatatatagtttaatgttgtattcatcgatatttgtcgaggatgactctgatgaagtaattttcttattgctaaattgaagccttaaaggtttc 663  Q
    ||||||||||    ||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| | ||||    
54728799 accactcata----gttta-tgttgtattgatctatatttgtcgaggatgactctgatgaagtaattttcttattgctaaattgatgtcttaatgttttc 54728705  T
664 ctcccctttttgggtgcggggaaataaaatatttggacttacatacatctcatcatttttctttattcagccaccatctaattgcttcacatgtccaaac 763  Q
     || | ||||||| ||| |     ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54728704 ttctc-tttttggttgctg-----taatatatttg-acttacatacatctcatcatttttctttattcagccaccatctaattgcttcacatgtccaaac 54728612  T
764 caaatcatctaagtccaaattcattagtattaattttctgggtgaagttgagaaaacttttagttcaacccacctaaattgaaattcaactgta 857  Q
    |||||||||||||| |||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54728611 caaatcatctaagttcaaattcattagt----attttctgggtgaagttgagaaaacttttagttcaacccacctaaattgaaattcaactgta 54728522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 126; E-Value: 2e-64
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 54728129 - 54727996
Alignment:
13 caaggacaagcagaacaagtgaagcagtagttttttgtcatagtgtgcaatatatgaatgaatattatcaagatctatattaattaacgtggccttgatg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54728129 caaggacaagcagaacaagtgaagcagtagttttttgtcatagtgtgcaatatatgaatgaatattatcaagatctatattaattaacgtggccttgatg 54728030  T
113 gtcatagaaggagataaatgtcactatgtttgaa 146  Q
    || |||||||||||||||||| ||||||||||||    
54728029 gttatagaaggagataaatgttactatgtttgaa 54727996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 83; E-Value: 8e-39
Query Start/End: Original strand, 877 - 967
Target Start/End: Complemental strand, 54728230 - 54728140
Alignment:
877 ttagacctatcgttgcctcagtattaacttcatctttctccagttgattatctcttcccacacccgcagcagcactatagccattcacaaa 967  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
54728230 ttagacctatcgttgcctcagtattagcttcatctttctccagttgattatctcttcccacacccgcagcaacactatagccattcacaaa 54728140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 174 - 256
Target Start/End: Complemental strand, 54729441 - 54729359
Alignment:
174 aattgttggaattttgatgctactaaggaggtttaaggctgttgcttgattgataatcttgtataagctccaacattccttga 256  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||    
54729441 aattgttggaattttgatgctactaaggaggtttacggctgttgcttgattggtaatcttgtataagctctaacattccttga 54729359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 480 - 555
Target Start/End: Complemental strand, 26588599 - 26588524
Alignment:
480 tgatggctgaaggtctgatcaggttggtgtctgcccatgcaagccaacagatttgtaccagagctacaaacaccta 555  Q
    |||||||| ||||| | ||||||||||||||||| ||| |||| || |||||||  ||||| ||||||||||||||    
26588599 tgatggctaaaggtttaatcaggttggtgtctgctcattcaagtcagcagatttacaccagggctacaaacaccta 26588524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110370 times since January 2019
Visitors: 1335