View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-50 (Length: 261)

Name: R108-tnk148-50
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-50
R108-tnk148-50
[»] chr8 (1 HSPs)
chr8 (1-261)||(14849527-14849787)
[»] chr6 (2 HSPs)
chr6 (1-261)||(33133387-33133647)
chr6 (1-259)||(17810941-17811197)
[»] chr5 (1 HSPs)
chr5 (1-261)||(11122294-11122554)
[»] chr2 (1 HSPs)
chr2 (1-261)||(32020615-32020875)
[»] chr1 (1 HSPs)
chr1 (1-261)||(44000943-44001203)
[»] chr7 (4 HSPs)
chr7 (2-259)||(21104719-21104976)
chr7 (12-196)||(36304630-36304825)
chr7 (177-261)||(36306888-36306964)
chr7 (120-181)||(36304825-36304886)
[»] chr4 (1 HSPs)
chr4 (1-259)||(12602977-12603235)
[»] chr3 (2 HSPs)
chr3 (173-258)||(16145349-16145434)
chr3 (9-114)||(10982220-10982325)


Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 14849787 - 14849527
Alignment:
1 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14849787 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 14849688  T
101 cgaagcatttggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggctagtgg 200  Q
    || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||    
14849687 cgcagcatttggggggccaaaagagttgttagcgaaggatacaagtggagcattggttcaggaactgatatttgtgtatgggaccagcggtggctagtgg 14849588  T
201 atgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 261  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14849587 atggtggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 14849527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 33133647 - 33133387
Alignment:
1 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33133647 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 33133548  T
101 cgaagcatttggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggctagtgg 200  Q
    || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||    
33133547 cgcagcatttggggggccaaaagagttgttagcgaaggatacaagtggagcattggttcaggaactgatatttgtgtatgggaccagcggtggctagtgg 33133448  T
201 atgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 261  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33133447 atggtggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 33133387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 17810941 - 17811197
Alignment:
1 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17810941 ggaaccacacaacattgtcaccagattgttcaaagcaaaatattttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 17811040  T
101 cgaagcatttggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggctagtgg 200  Q
    || |||||||| ||||||  ||||||||| || ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
17811041 cgcagcatttgaggggcc--aagagttgttagtgaatgatacaagtggagcattggttcaggaactgatatttgtgtatgggaccaacgatggctagtgg 17811138  T
201 atgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgtt 259  Q
    ||| |||| || ||||||||||||||||| ||||||||||||||||| |||||||||||    
17811139 atggtggtcttttacagaagccagaaagtttgccagaagaattcaaatagcttactgtt 17811197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 11122294 - 11122554
Alignment:
1 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11122294 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 11122393  T
101 cgaagcatttggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggctagtgg 200  Q
    || | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||    
11122394 cgcaacatttggggggccaaaagagttgttagcgaaggatacaagtggagcattggttcaggaactgatatttgtgtatgggaccagcggtggctagtgg 11122493  T
201 atgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 261  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11122494 atggtggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 11122554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 32020875 - 32020615
Alignment:
1 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32020875 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 32020776  T
101 cgaagcatttggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggctagtgg 200  Q
    || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||    
32020775 cgcagcatttggggggccaaaagagttgttagcgaaggatacaagtggagcattggttcaggaactgatatttgtgtatgggaccagcggtggctagtgg 32020676  T
201 atgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 261  Q
    ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
32020675 atggtggtgttctacagaagccagaaagtgtgccagaagaattcaaagagcttactgttgc 32020615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 44000943 - 44001203
Alignment:
1 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||    
44000943 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaattgtgatttcttgtactcaaagattggtcacaatccaagctacgtttgg 44001042  T
101 cgaagcatttggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggctagtgg 200  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||    
44001043 cgaagcatttggggggccaaaagagttgttagcgaaggatacaagtggagcattggttcaggaactgatatttgtgtatgggaccagcggtggctagtgg 44001142  T
201 atgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 261  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44001143 atggtggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 44001203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 2 - 259
Target Start/End: Complemental strand, 21104976 - 21104719
Alignment:
2 gaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttggc 101  Q
    ||||| |||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| ||| |||||||| ||||||||||||||||||| ||||    
21104976 gaaccgcacaacattgtcactagattattcaaagcaaaatactttaacaagtgtgatttcttagacgcaaagattagtcacaatccaagctacgtctggc 21104877  T
102 gaagcatttggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggctagtgga 201  Q
    | |||||||||||||||||||||||||| |||||||||||||  ||||||||||||||||| |||| ||| | |||||||||||||||||||||||||||    
21104876 gcagcatttggggggccaaaagagttgttagcgaaggatacacatggagcattggttcaggtactgatatatttgtatgggaccaacgatggctagtgga 21104777  T
202 tgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgtt 259  Q
    || ||||||| ||||||||||| || | ||||||||||||||||||||||||||||||    
21104776 tggtggtgttttacagaagccaaaatggctgccagaagaattcaaagagcttactgtt 21104719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 12 - 196
Target Start/End: Original strand, 36304630 - 36304825
Alignment:
12 acattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttggcgaagcattt- 110  Q
    ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||  |||||||     
36304630 acattgtcaccagatcgttcaaagcaaaatattttaacaaatgtgatttcttggactcaaagattggtcacagtccaagctacgtttggctcagcatttg 36304729  T
111 ----------ggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggcta 196  Q
              |||||| |||||||||||| |||||||| ||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||    
36304730 gggggggggggggggggcaaaagagttgttagcgaagggtacaagtggagtattggttcaggtactgatatttgtgtatgggaccaacgatggcta 36304825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 177 - 261
Target Start/End: Original strand, 36306888 - 36306964
Alignment:
177 tatgggaccaacgatggctagtggatgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgttgc 261  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||        ||||||||||||||||||||||||||||||    
36306888 tatgggaccaacgatggctagtggatggtggtgttctacagaagcca--------gccagaagaattcaaagagcttactgttgc 36306964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 120 - 181
Target Start/End: Original strand, 36304825 - 36304886
Alignment:
120 aaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgg 181  Q
    |||||||||| |||||||||||||| ||||| ||||||||||| |||| |||||||||||||    
36304825 aaagagttgttagcgaaggatacaaatggagtattggttcaggtactgatatttgtgtatgg 36304886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 12603235 - 12602977
Alignment:
1 ggaaccacacaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttgg 100  Q
    |||||| ||||||| |||||| ||||| ||||||||||||||||||||||| |||| |||||||||| |||||||||||||| ||| ||||||||| |||    
12603235 ggaaccgcacaacaatgtcactagattattcaaagcaaaatactttaacaagtgtggtttcttggacccaaagattggtcacgatctaagctacgtctgg 12603136  T
101 cgaagcatttggggggccaaaagagttgtcagcgaaggatacaagtggagcattggttcaggaactggtatttgtgtatgggaccaacgatggctagtgg 200  Q
    ||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||| | |||| ||| ||||||||||||||||||||||||||||    
12603135 cgaagcatttggggggccaaaagagttgttagcaaaggatacaaatggagcattggttcaagtactgatatatgtgtatgggaccaacgatggctagtgg 12603036  T
201 atgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgtt 259  Q
    ||| ||||||| ||||||||||| |||||||  |||||||||||||| |||||||||||    
12603035 atggtggtgttttacagaagccaaaaagtctttcagaagaattcaaaaagcttactgtt 12602977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 173 - 258
Target Start/End: Complemental strand, 16145434 - 16145349
Alignment:
173 tgtgtatgggaccaacgatggctagtggatgatggtgttctacagaagccagaaagtctgccagaagaattcaaagagcttactgt 258  Q
    ||||| |||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||    
16145434 tgtgtttgggaccagcgatggctagtggatgatggtgttttacagaagtcagaaagtctgccagaagaattcaaagagcttactgt 16145349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 9 - 114
Target Start/End: Complemental strand, 10982325 - 10982220
Alignment:
9 acaacattgtcaccagattgttcaaagcaaaatactttaacaaatgtgatttcttggactcaaagattggtcacaatccaagctacgtttggcgaagcat 108  Q
    ||||||| ||||| ||||| |||||||| ||||| |||   ||||||||||| ||||| || | |  ||| ||||||||||| ||||||||||| || ||    
10982325 acaacatagtcactagattattcaaagccaaatattttccgaaatgtgattttttggattctaggtgtggacacaatccaagttacgtttggcgcagtat 10982226  T
109 ttgggg 114  Q
    ||||||    
10982225 ttgggg 10982220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110846 times since January 2019
Visitors: 1335