View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-51 (Length: 128)

Name: R108-tnk148-51
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-51
R108-tnk148-51
[»] chr3 (1 HSPs)
chr3 (3-128)||(42786533-42786661)


Alignment Details
Target: chr3 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 3 - 128
Target Start/End: Complemental strand, 42786661 - 42786533
Alignment:
3 attcacgcacgggttcctttaccagggcaggacctcaatggacgacaaaattctcgatcaagagttttgtagttgctgcat---ttatattgctggattt 99  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||   |||||||||||||||     
42786661 attcacgcacgggttccttgaccagggcaggacctcaatggacgacaaaattctcgatcaagagttttgtagttgttgcatttattatattgctggattc 42786562  T
100 gaactcaacacatcaagtgaaattagaaa 128  Q
     ||||||||||||||||||||||||||||    
42786561 aaactcaacacatcaagtgaaattagaaa 42786533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176028 times since January 2019
Visitors: 1577