View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-52 (Length: 254)

Name: R108-tnk148-52
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-52
R108-tnk148-52
[»] chr1 (2 HSPs)
chr1 (1-254)||(11954199-11954452)
chr1 (1-193)||(11980337-11980526)


Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 11954199 - 11954452
Alignment:
1 tgtaatccaataactcaatccttcaagaagttgccgattgggtcaattatgatttggcgtcttttaggaatgacaatgaatgggagtgcaggttacagag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||| |||||||    
11954199 tgtaatccaataactcaatccttcaagaagttgccgattgggtcaattaagatttggcgtcttttagggatgacaatgaatgtgagtgcaggctacagag 11954298  T
101 tcctaaaattgggatgtgatagaacatttgaaatttacgattcaataacgaagtgttggagccatctaaaaaagatacctatatgtattaaggagctaga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
11954299 tcctaaaattgggatgtgatagaacatttgaaatttacgattcaataacgaagtgttggagccatctaaaaaagatacctatatgtattaagaagctaga 11954398  T
201 cgatactatttccaacattgtttccattgacaccactctttatttcaagcataa 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11954399 cgatactatttccaacattgtttccattgacaccactctttatttcaagcataa 11954452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 11980337 - 11980526
Alignment:
1 tgtaatccaataactcaatccttcaagaagttgccgattgggtcaattatgatttggcgtcttttaggaatgacaatgaatgggagtgcaggttacagag 100  Q
    ||||||||||| ||| ||||||||||||||||||||| ||| |  |||| |   ||| ||| |||||| ||||||||||||||||||||||  ||||| |    
11980337 tgtaatccaatgactaaatccttcaagaagttgccgaatggttggattaagcggtggtgtcatttagggatgacaatgaatgggagtgcagactacaggg 11980436  T
101 tcctaaaattgggatgtgatagaacatttgaaatttacgattcaataacgaagtgttggagccatctaaaaaagatacctatatgtattaagg 193  Q
    ||||||||||||| ||   ||||| || |||||||||||||||| |||| || || ||||| ||||||  ||||||||||  |||||||||||    
11980437 tcctaaaattgggttg---tagaaaatatgaaatttacgattcagtaacaaaatgctggagtcatctaggaaagatacctgaatgtattaagg 11980526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361989 times since January 2019
Visitors: 488