View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-56 (Length: 168)

Name: R108-tnk148-56
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-56
R108-tnk148-56
[»] chr6 (2 HSPs)
chr6 (1-168)||(10538205-10538372)
chr6 (1-121)||(10586868-10586985)


Alignment Details
Target: chr6 (Bit Score: 164; Significance: 6e-88; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 10538372 - 10538205
Alignment:
1 aaatgtacatattccagtccttcaagtatgaaggtacatatatagtgacaaaacagcaagcatcaaggagtgatatttccttggtttgccctaattacaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10538372 aaatgtacatattccagtccttcaagtatgaaggtacatatatattgacaaaacagcaagcatcaaggagtgatatttccttggtttgccctaattacaa 10538273  T
101 gctcttcagtggtggcaccaattatttcatttgctcttttcaatccaacacattgatatcgtcctata 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10538272 gctcttcagtggtggcaccaattatttcatttgctcttttcaatccaacacattgatatcgtcctata 10538205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 57; E-Value: 4e-24
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 10586868 - 10586985
Alignment:
1 aaatgtacatattccagtccttcaagtatgaaggtacatatatagtgacaaaacagcaagcatcaaggagtgatatttcc-ttggtttgccctaattaca 99  Q
    |||||||||| ||| ||  ||| ||||||||||||||||||    |||||||||| |||||||||||||||||||||||| ||  |||| ||||||||||    
10586868 aaatgtacattttctagctctttaagtatgaaggtacatat----tgacaaaacaacaagcatcaaggagtgatatttcctttattttgtcctaattaca 10586963  T
100 agctcttcagtggtggcaccaa 121  Q
    |||||||||||||| |||||||    
10586964 agctcttcagtggtagcaccaa 10586985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 311948 times since January 2019
Visitors: 444