View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-57 (Length: 200)

Name: R108-tnk148-57
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-57
R108-tnk148-57
[»] chr2 (2 HSPs)
chr2 (1-200)||(10188167-10188356)
chr2 (85-151)||(9818636-9818705)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 10188167 - 10188356
Alignment:
1 tctttctctctctacaaatacaaaaccctctcactcctcaagctcagagggccacactgcaaacnnnnnnnnnnnnnnnnnnnnatgagggaaggtggag 100  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||                     ||||||||||||||||    
10188167 tctttctctctctacaaatacaaaaccctctcactcctcaaactcagagggccacactgcaaa----------agagagagagaatgagggaaggtggag 10188256  T
101 gaagaagaggaacatcaaagctaagagaagtagcacggaaaattgttgttgttgcagcagcatatgcatgtgcttcattctcaagaagaaaaacnttggt 200  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
10188257 gaagaagaggaacatcaaagctaagagaagtagcaaggaaaattgttgttgttgcagcagcatatgcatgtgcttcattctcaagaagaaaaacattggt 10188356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 85 - 151
Target Start/End: Complemental strand, 9818705 - 9818636
Alignment:
85 atgagggaaggtggaggaagaagaggaacatcaa---agctaagagaagtagcacggaaaattgttgttg 151  Q
    |||||| || ||||||||||||||||||||||||   ||||||||||||||||| ||||| |||||||||    
9818705 atgaggtaatgtggaggaagaagaggaacatcaaattagctaagagaagtagcaaggaaagttgttgttg 9818636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176053 times since January 2019
Visitors: 1578