View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-7 (Length: 1127)

Name: R108-tnk148-7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-7
R108-tnk148-7
[»] chr2 (3 HSPs)
chr2 (261-1127)||(7158001-7158888)
chr2 (20-264)||(7158912-7159156)
chr2 (162-253)||(7179653-7179744)
[»] chr7 (2 HSPs)
chr7 (178-264)||(24798007-24798093)
chr7 (174-255)||(24725859-24725940)
[»] chr4 (2 HSPs)
chr4 (841-881)||(35067422-35067462)
chr4 (839-916)||(37483092-37483169)
[»] chr8 (1 HSPs)
chr8 (846-916)||(28489108-28489178)


Alignment Details
Target: chr2 (Bit Score: 720; Significance: 0; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 720; E-Value: 0
Query Start/End: Original strand, 261 - 1127
Target Start/End: Original strand, 7158001 - 7158888
Alignment:
261 aattcttatgtgtatttataatcttaacatctcacaggaggactgtgaagaaaaagtttcctgtgttattatgtgaacttcttaattgaaccattagcct 360  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7158001 aattcttgtgtgtatttataatcttaacatctcacaggaggactgtgaagaaaaagtttcctgtgttattatgtgaacttcttaattgaaccattagcct 7158100  T
361 aaatggtcgtggaagataagtactggtcaccagactcacgaatacatccctggcaaaaattgcttagatgtccttacatcttcttctccacggatcaggt 460  Q
    |||||| |||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||    
7158101 aaatggccgtggaagataagtactggtcaccagactcaccaatacatccctagaaaaaattgcttagatgtccttacatcttcttctccacggatcaggt 7158200  T
461 agctcccgttattttcctcttttcctcctcctgcaccaatactcttttcttttatatctttggtctccacctcctcatcctcctctctatttgcgccacc 560  Q
    | ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7158201 aactcccgttattttcctcttttcctcttcctgtaccaatactcttttcttttatatctttggtctccacctcctcatcctcctctctatttgcgccacc 7158300  T
561 ccccgttgacacagtgcctccacatggacatcaacaaggtggggcagcaggtggctttgttctcccaacaataaagaattgttttaactcccttgaatcg 660  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7158301 tcccgttgacacagtgcctccacatggacatcaacaaggtggggcagcaggtggctttgttctcccaacaataaagaattgttttaactcccttgaatcg 7158400  T
661 aagatgaagcaggggaaggtattgaaaccaaatcagaatgtgctgatgttgacacaaccaggattctcagagaccctcactttggatgccaaatccatat 760  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
7158401 aagatgaagcaggggaaggtattgaaaccaaatcagaatgtgctgatgttgacacaaccaggcttctcagagaccctcactttggatgccaaatccatat 7158500  T
761 tgca--nnnnnnnnnnacaatctgtatctctagtggccgcataaaat-----------agcaaacgcttcaatatcttaaatactacatcgagccactta 847  Q
    ||||            |||||||||||||||||||||||||||||||           |||||| |||||||||||||||||||||||||||||||||||    
7158501 tgcattttttttttttacaatctgtatctctagtggccgcataaaatacaactttctcagcaaaagcttcaatatcttaaatactacatcgagccactta 7158600  T
848 aatactccaccaaacattttatactactcgatgtagggcttaggcatccgatagtaaccaagtccctattagacaatcacaaggagaatgaagggaatga 947  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7158601 aatactccaccaaacattttatactactcgatgcaggccttaggcatccgatagtaaccaagtccctattagacaatcacaaggagaatgaagggaatga 7158700  T
948 ctcaacattgaaacaacaaatgaaatctctgaacagatga--------tagtgatataatttagcttactaacaaggctttggcaccctcttggatcagt 1039  Q
    ||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||    
7158701 ctcaacattgaaacaacaaatgaaatctctgaacagatgatagtgaattagtgatataatttagcttactaacaaggctttggcaccctcttggatcagt 7158800  T
1040 aaatgggcctcctttccagggaggagttcatggaagagtcagcaattttacagtctaacatgccagttcccttgagaatgtcgaatac 1127  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
7158801 aaatgggcctcctgtccagggaggagttcatggaagagtcagcaattttacagtctaacatgccagttcccttgagaatgtcggatac 7158888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 20 - 264
Target Start/End: Original strand, 7158912 - 7159156
Alignment:
20 accagtgagattgagattgtttgtaacaacctcaatgcatataatctttattgttccagcttgaggggagcgttggagttctaagtattgaacccataag 119  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
7158912 accagtgagattgagattatttgtaacaacctcaatgcatataatctttattgttccagcttgaggggactgttggagttctaagtattgaacccataag 7159011  T
120 cccattagtgtatttgtaaatatattcttgtaatctctcaccgcaggtggtggagttctcgactgaacaagcacaggcacaccatctgaacccagtccta 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7159012 cccattagtgtatttgtaaatatattcttgtaatctctcaccgcaggtggtggagttctcgactgaacaagcacaggcacaccatctgaacccagtccta 7159111  T
220 atgttatgaataacaatgccaatagaaaataaacttgccccaatt 264  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
7159112 atgttatgaataacaatgccaatagaaaataaacttgccccaatt 7159156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 68; E-Value: 9e-30
Query Start/End: Original strand, 162 - 253
Target Start/End: Original strand, 7179653 - 7179744
Alignment:
162 gcaggtggtggagttctcgactgaacaagcacaggcacaccatctgaacccagtcctaatgttatgaataacaatgccaatagaaaataaac 253  Q
    ||||||||||||||||| |||||||||||  ||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||    
7179653 gcaggtggtggagttcttgactgaacaagtgcaggcacaccatctgaacccagtcctattgttatgaataacaatgccgacagaaaataaac 7179744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 51; Significance: 1e-19; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 178 - 264
Target Start/End: Complemental strand, 24798093 - 24798007
Alignment:
178 tcgactgaacaagcacaggcacaccatctgaacccagtcctaatgttatgaataacaatgccaatagaaaataaacttgccccaatt 264  Q
    |||||| ||||||| || ||||||||||||||||||   ||||||||||| ||||||||||| ||||||||||||||||||| ||||    
24798093 tcgacttaacaagcgcacgcacaccatctgaacccaacactaatgttatggataacaatgccgatagaaaataaacttgcccaaatt 24798007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 174 - 255
Target Start/End: Complemental strand, 24725940 - 24725859
Alignment:
174 gttctcgactgaacaagcacaggcacaccatctgaacccagtcctaatgttatgaataacaatgccaatagaaaataaactt 255  Q
    |||||||| ||||||||| || || |||||||||||||||   ||||||||||||||||||||||| |||||||||||||||    
24725940 gttctcgaatgaacaagcgcatgctcaccatctgaacccaacactaatgttatgaataacaatgccgatagaaaataaactt 24725859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000007; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 841 - 881
Target Start/End: Original strand, 35067422 - 35067462
Alignment:
841 ccacttaaatactccaccaaacattttatactactcgatgt 881  Q
    ||||||||||||||||||||||||  |||||||||||||||    
35067422 ccacttaaatactccaccaaacatcctatactactcgatgt 35067462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 839 - 916
Target Start/End: Complemental strand, 37483169 - 37483092
Alignment:
839 agccacttaaatactccaccaaacattttatactactcgatgtagggcttaggcatccgatagtaaccaagtccctat 916  Q
    ||||||||||||||||||||||||||   |||||||| ||||| |  ||| |||| || ||| || ||||||||||||    
37483169 agccacttaaatactccaccaaacatcccatactacttgatgtggaacttgggcaccccataatacccaagtccctat 37483092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 846 - 916
Target Start/End: Original strand, 28489108 - 28489178
Alignment:
846 taaatactccaccaaacattttatactactcgatgtagggcttaggcatccgatagtaaccaagtccctat 916  Q
    |||||| || ||||||||| | |||||||| |||||||| ||||| ||||| ||| || ||||||||||||    
28489108 taaatattcaaccaaacatctcatactacttgatgtaggacttagacatcccataatatccaagtccctat 28489178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 312969 times since January 2019
Visitors: 445