View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk148-8 (Length: 1128)

Name: R108-tnk148-8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk148-8
R108-tnk148-8
[»] chr5 (4 HSPs)
chr5 (15-382)||(14264710-14265078)
chr5 (584-737)||(14379089-14379244)
chr5 (345-394)||(14379379-14379428)
chr5 (1-91)||(14263599-14263688)


Alignment Details
Target: chr5 (Bit Score: 341; Significance: 0; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 15 - 382
Target Start/End: Original strand, 14264710 - 14265078
Alignment:
15 caatcaatagagcttagaaaataaaaggagtggaaaagaattgtttttgttttgagaatgtttaattgcttaatttcgtgaatggtaggattcaccaaca 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
14264710 caatcaatagagcttagaaaataaaaggagtggaaaagaattgtttttgttttgagaatgtttaatcgcttaatttcgtgaatggtaggattcaccaaca 14264809  T
115 tatatgtttctaacttaggtcatttgcttaactaaagtgaatgagaagagcactactgtattctcagggcggtgtttactatgtgagattatatgttatg 214  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
14264810 tatatgtttctaacttaggtcatttgctcaactaaagtgaatgagaagagcagtactgtattctcagggcggtgtttactatgtgagattatatgttatg 14264909  T
215 -tttttatttgacaaagcatgtccgtacatacatggtgacctctagaagttacatttgccataaggaactccctagtatcttcatttgtttacagaacaa 313  Q
     ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
14264910 ttttttatttgacaaagcatgtccttacatacatggtgacctctagaagttacatttgccataaggaactccctagtatcttcatttgcttacagaacaa 14265009  T
314 tctactgataactcttgactaaattcctagagctaaaagtaaaaatcatggttcaaatgtttagcttga 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14265010 tctactgataactcttgactaaattcctagagctaaaagtaaaaatcatggttcaaatgtttagcttga 14265078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 8e-21
Query Start/End: Original strand, 584 - 737
Target Start/End: Complemental strand, 14379244 - 14379089
Alignment:
584 tatcatcggacaaaataacattcaagtggattgaaaaattgctctccaaaagtggccataat--gtaagatgtagcacgacaaagagatcatacgacgat 681  Q
    ||||| ||||||||||||||| ||| | ||||||||||  ||||||||||| ||    ||||  |||||||||||||||| | |||| || | |||| |     
14379244 tatcaacggacaaaataacatacaaatagattgaaaaaaagctctccaaaattgcatgtaatatgtaagatgtagcacgatagagaggtcttgcgacaag 14379145  T
682 gaacacaaattcagtgtgtgtttttcttgagtaggttcaaggtggccggaaacagc 737  Q
     |||||||||||||||| ||||||||||||| | ||||||||||| ||||||||||    
14379144 taacacaaattcagtgtttgtttttcttgagcaagttcaaggtggtcggaaacagc 14379089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 345 - 394
Target Start/End: Complemental strand, 14379428 - 14379379
Alignment:
345 gctaaaagtaaaaatcatggttcaaatgtttagcttgatctcttcttttg 394  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
14379428 gctaaaagtaaaaatcatggttcaaatgtttagcttgatctcttcttttg 14379379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 14263599 - 14263688
Alignment:
1 attgttgttgtgctcaatcaatagagcttagaaaataaaa-ggagtggaaaagaattgtttttgttttgagaatgtttaattgcttaatttc 91  Q
    |||||||||||||||||| |||||| |||||||||||||| ||| | ||||| |||||| |||||||||||||| ||| ||  |||||||||    
14263599 attgttgttgtgctcaat-aatagaacttagaaaataaaagggatttgaaaa-aattgtgtttgttttgagaattttttatcacttaatttc 14263688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203328 times since January 2019
Visitors: 1517