View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk176-2 (Length: 819)

Name: R108-tnk176-2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk176-2
R108-tnk176-2
[»] chr8 (6 HSPs)
chr8 (1-241)||(9526000-9526249)
chr8 (672-819)||(9526245-9526392)
chr8 (490-675)||(9525653-9525832)
chr8 (490-675)||(24607703-24607882)
chr8 (283-388)||(9525895-9525998)
chr8 (283-388)||(24607537-24607640)
[»] chr1 (1 HSPs)
chr1 (506-653)||(11450615-11450760)
[»] chr2 (2 HSPs)
chr2 (599-675)||(16939700-16939775)
chr2 (599-675)||(17010365-17010440)


Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 9526249 - 9526000
Alignment:
1 catttatgaaattgctagaagagattaatagtgtagtttctaaaa-ggcattggaatgtggtaatgtgaaggggattgcactaaaagggtctaagattga 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9526249 catttatgaaattgctagaagagattaatagtgtagtttctaaaaaggcattggaatgtggtaatgtgaaggggattgcactaaaagggtctaagattga 9526150  T
100 tgtaatttcaggtgctgaattggaaattagtgagataaagaagttgtcttcatgctcttgttgatgttgttatttaatgattaattaagttgtatttgat 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
9526149 tgtaatttcaggtgctgaattggaaattagtgagataaagaagttgtcttcatgctcttgttgatgttgttatctaatgattaattaagttgtatttgat 9526050  T
200 tttgaagtttggg--------aaaaaaggagtgtgacaagtacatatatg 241  Q
    |||||||||||||        |||||||||||||||||||||||||||||    
9526049 tttgaagtttggggaaaaaaaaaaaaaggagtgtgacaagtacatatatg 9526000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 140; E-Value: 7e-73
Query Start/End: Original strand, 672 - 819
Target Start/End: Complemental strand, 9526392 - 9526245
Alignment:
672 aattgtgatcatgctagttggtaacaaaggtgaccttgttgacttgagaatggttcctactgaagatgcagttgagtttgcagaagaccaaggtttattc 771  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
9526392 aattgtgatcatgctagttggtaacaaaggtgaccttgttgatttgagaatggtccctactgaagatgcagttgagtttgcagaagaccaaggtttattc 9526293  T
772 ttctcagagacttcagctcttactggtgtgaatgtggagggtgcattt 819  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
9526292 ttctcagagacttcagctcttactggtgtgaatgtggagggtgcattt 9526245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 490 - 675
Target Start/End: Complemental strand, 9525832 - 9525653
Alignment:
490 ttaaaatgtacatgttgacttgtgccttgttggtagagtggtggtgaataaaccaattcacttatctacaatcgaataaaggttagggttcaatttggca 589  Q
    ||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||  | |  || |  | ||||         
9525832 ttaaaatctacatgttgacttgtgccttattgatagagtggtggtgaataaaccaattcacttatccacaatcgaa-gatgcataagaataaatt----c 9525738  T
590 accatgtaaacaaatggatttaatccagatggataacaatgaaattcatggtccagctgttccacaaaggtgatcttgaaagaatt 675  Q
    |  ||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||| ||||||||||||||||    
9525737 atgatggaaacaaatggatttaatccagatggataacaat-aaattcatggtccagttgttccgcaaagatgatcttgaaagaatt 9525653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 490 - 675
Target Start/End: Original strand, 24607703 - 24607882
Alignment:
490 ttaaaatgtacatgttgacttgtgccttgttggtagagtggtggtgaataaaccaattcacttatctacaatcgaataaaggttagggttcaatttggca 589  Q
    ||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||  | |  || |  | ||||         
24607703 ttaaaatctacatgttgacttgtgccttattgatagagtggtggtgaataaaccaattcacttatccacaatcgaa-gatgcataagaataaatt----c 24607797  T
590 accatgtaaacaaatggatttaatccagatggataacaatgaaattcatggtccagctgttccacaaaggtgatcttgaaagaatt 675  Q
    |  ||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||| ||||||||||||||||    
24607798 atgatggaaacaaatggatttaatccagatggataacaat-aaattcatggtccagttgttccgcaaagatgatcttgaaagaatt 24607882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 283 - 388
Target Start/End: Complemental strand, 9525998 - 9525895
Alignment:
283 atttcatatggtcttgctttatgtgctaagaactgaatagttggttatcatgtttcattgtgactatgatttattacatttataactcatctacaatatt 382  Q
    ||||||| |||||||||||| ||||||||||||||||| |||| ||||||||||||||||||| ||| | || | |||||||||||||||||||||||||    
9525998 atttcatctggtcttgctttctgtgctaagaactgaat-gttg-ttatcatgtttcattgtgattattacttgtgacatttataactcatctacaatatt 9525901  T
383 cattaa 388  Q
    ||||||    
9525900 cattaa 9525895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 283 - 388
Target Start/End: Original strand, 24607537 - 24607640
Alignment:
283 atttcatatggtcttgctttatgtgctaagaactgaatagttggttatcatgtttcattgtgactatgatttattacatttataactcatctacaatatt 382  Q
    ||||||| |||||||||||| ||||||||||||||||| |||| ||||||||||||||||||| ||| | || | |||||||||||||||||||||||||    
24607537 atttcatctggtcttgctttctgtgctaagaactgaat-gttg-ttatcatgtttcattgtgattattacttgtgacatttataactcatctacaatatt 24607634  T
383 cattaa 388  Q
    ||||||    
24607635 cattaa 24607640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 506 - 653
Target Start/End: Original strand, 11450615 - 11450760
Alignment:
506 gacttgtgccttgttggtagagtggtggtgaataaaccaattcacttatctacaatcgaataaaggttagggttcaatttggcaaccatgtaaacaaatg 605  Q
    ||||| |||||| ||| ||||||||| |||||||||||||||||| |||| ||||||||| ||| | |  |||    ||||||||||||| | | |||||    
11450615 gacttatgccttattgatagagtggtagtgaataaaccaattcacatatccacaatcgaagaaaagat-cggtctggtttggcaaccatggagaaaaatg 11450713  T
606 gatttaatccagatggataacaatgaaattcatggtccagctgttcca 653  Q
    ||||||||||| ||||| |||||  || ||||||||||||||||||||    
11450714 gatttaatccaaatggagaacaa-caagttcatggtccagctgttcca 11450760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000005; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 599 - 675
Target Start/End: Original strand, 16939700 - 16939775
Alignment:
599 acaaatggatttaatccagatggataacaatgaaattcatggtccagctgttccacaaaggtgatcttgaaagaatt 675  Q
    ||||||||||||||| |  |||||||||||  ||||||||||| || || ||| |||||||||||| ||||||||||    
16939700 acaaatggatttaattccaatggataacaac-aaattcatggttcaacttttcaacaaaggtgatcatgaaagaatt 16939775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 599 - 675
Target Start/End: Original strand, 17010365 - 17010440
Alignment:
599 acaaatggatttaatccagatggataacaatgaaattcatggtccagctgttccacaaaggtgatcttgaaagaatt 675  Q
    ||||||||||||||| |  |||||||||||  ||||||||||| || || ||| |||||||||||| ||||||||||    
17010365 acaaatggatttaattccaatggataacaac-aaattcatggttcaacttttcaacaaaggtgatcatgaaagaatt 17010440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108194 times since January 2019
Visitors: 1329