View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk176-6 (Length: 380)

Name: R108-tnk176-6
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk176-6
R108-tnk176-6
[»] chr4 (2 HSPs)
chr4 (170-380)||(21442266-21442476)
chr4 (1-175)||(21442472-21442646)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 170 - 380
Target Start/End: Original strand, 21442266 - 21442476
Alignment:
170 gaattctttgctaaaactcctattaactaacattgaagtaccgaccgagctaacacactttataatccattttctccatctagagagaaaattcattccc 269  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21442266 gaattctttgctaaaactcctattaactaatattgaagtaccgaccgagctaacacactttataatccattttctccatctagagagaaaattcattccc 21442365  T
270 ttcattgtcgaatctatgtccccttatcaactaaattataaatcttttcaaagacaaatttgagtcaaataagttatctttaactttacttagattcatc 369  Q
    |||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||    
21442366 ttcattgtcgaatctatgtctccttatcaactaaatcataagtcttttcaaagacaaatttgaataaaataagttatctttaacttttcttagattcatc 21442465  T
370 aacggnctcat 380  Q
    ||||| |||||    
21442466 aacggtctcat 21442476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 21442472 - 21442646
Alignment:
1 ctcattagcaataaaaatatcactcaaagtttgtcganntttaacaaacgtcaaatgaggttttgataattacaagaccaatagttgacaaataaaataa 100  Q
    |||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
21442472 ctcattagcaataaaaatatcattcaaagtttgtcgatttttaacaaacgtcaaatgaggtttcgataattacaagaccaatagttgacaaataaaataa 21442571  T
101 agtagtagatatatctcgtgtatccgcaatttcttttttcaaatagatttgtcnnnnnnntttcagtttgaattc 175  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||       |||||||||||||||    
21442572 agtagtagatatatctcgtgtatccgcaatttctttttttaaatagatttgtcaaataattttcagtttgaattc 21442646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126724 times since January 2019
Visitors: 1391