View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk176-7 (Length: 299)

Name: R108-tnk176-7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk176-7
R108-tnk176-7
[»] chr4 (2 HSPs)
chr4 (54-299)||(45565436-45565669)
chr4 (1-35)||(45565665-45565699)
[»] chr8 (1 HSPs)
chr8 (193-225)||(45286940-45286972)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 54 - 299
Target Start/End: Original strand, 45565436 - 45565669
Alignment:
54 tgtttgcttctttcggactgtttcccactgatataaagcttcaggtgcacgctggacagcacctgtggcagcacctgcgcctctgctaactgaatcccac 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||    
45565436 tgtttgcttctttcggactgtttcccactgatataaagcttcaggtgcacgctggacagc------------acctgcgcctctgctaactgaatcccac 45565523  T
154 agatcagcctcgcaccatatttgttttgccgctttacatccaatcgttctcatagtttgtttcacaatggggacatccatttgaacatagaactcctctc 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
45565524 agatcagcctcgcaccatatttgttttgccgctttacatccaatcgttctcatagtttgtttcacaatggggacatccatttgaacatggaactcctctc 45565623  T
254 tcttgaagactcataagagtaggaagaatacctccaagcacacttc 299  Q
    | |||||| |||||||||||||||||||||||||||||||||||||    
45565624 ttttgaagtctcataagagtaggaagaatacctccaagcacacttc 45565669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 45565665 - 45565699
Alignment:
1 acttcaaagaaaaactttgatctgttagagaattc 35  Q
    ||||||||||||||||||||||||||| |||||||    
45565665 acttcaaagaaaaactttgatctgttacagaattc 45565699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 225
Target Start/End: Complemental strand, 45286972 - 45286940
Alignment:
193 ccaatcgttctcatagtttgtttcacaatgggg 225  Q
    |||||||||||| ||||||||||||||||||||    
45286972 ccaatcgttctcgtagtttgtttcacaatgggg 45286940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361800 times since January 2019
Visitors: 488