View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk176-8 (Length: 1555)

Name: R108-tnk176-8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk176-8
R108-tnk176-8
[»] chr1 (8 HSPs)
chr1 (911-1491)||(8104324-8104882)
chr1 (628-908)||(8103743-8104026)
chr1 (628-826)||(8102245-8102443)
chr1 (628-793)||(8099484-8099649)
chr1 (594-635)||(8105049-8105090)
chr1 (62-106)||(8104977-8105021)
chr1 (136-169)||(8105019-8105052)
chr1 (1216-1251)||(8100372-8100407)
[»] chr4 (3 HSPs)
chr4 (738-823)||(21261245-21261329)
chr4 (702-776)||(13779742-13779817)
chr4 (702-811)||(35033429-35033538)
[»] chr3 (1 HSPs)
chr3 (679-748)||(42957764-42957833)
[»] chr2 (1 HSPs)
chr2 (702-811)||(28198770-28198879)


Alignment Details
Target: chr1 (Bit Score: 432; Significance: 0; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 432; E-Value: 0
Query Start/End: Original strand, 911 - 1491
Target Start/End: Original strand, 8104324 - 8104882
Alignment:
911 tatttatatgcttcaagatttttggtttttctaccgcttctaattgattgttgttgggagtaggagatactattttgttgtatttgacattttgacttga 1010  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||     
8104324 tatttatatgcttcaagatttttggtttttctaccgcttctaattgattgttgttgg-agtaggagatactattttgttgtatttgacattttgacttgg 8104422  T
1011 ctttaatacaaaatgctagttaaaggaaaatgagaatataataaacttgtttcaaaaactcaaatagagtaaatgataaatagaggtattcattgattta 1110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||    
8104423 ctttaatacaaaatgctagttaaaggaaaatgagaatataataaacttctttaaaaaagtcaaatagagtaaatgataaatagaggtattcattgattta 8104522  T
1111 attaattaatactcccatcttcctccctctctccagaattatacccaataaattttattaccttattttgtaccttgaaaactgttcttagtttcccttg 1210  Q
    |||||||||||||||| ||||||| ||||||||||||||||||  ||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||    
8104523 attaattaatactccc-tcttcct-cctctctccagaattataaacaataaattttattaacttattttgtaacttgaaaactgttcttagttt-ccttg 8104619  T
1211 gtttaattttgattgtgcttattgttagttatattaattttatgagagactggaaatatattatatagagggctatagtaatattaatttcacaaaaagt 1310  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
8104620 gtttaattttgattgtgcttattgttagttatattaattttatcagagactggaaatatattatataga-ggctatagtaatattaatttcacaaaaagt 8104718  T
1311 tttttccctctnnnnnnnngttataataatttcttttagattagcatgttatttgtatgtagttttcagcgttgtttatctgtaggacaggacacacaag 1410  Q
    ||||| ||||                |||||| |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
8104719 ttttt-cctc----------------taatttattttagattaccatgttatttgaatgtagttttcagcgttgtttatctgtaggacaggacacacaag 8104801  T
1411 ggagattcttcctacgcaggtaacagcaatgggtgcaatggtggatgagttagttagttagttagctcggcatttgtatat 1491  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8104802 ggagattcttcctacgcaggtaacagcaatgggtgcaatggtggatgagttagttagttagttagctcggcatttgtatat 8104882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 628 - 908
Target Start/End: Original strand, 8103743 - 8104026
Alignment:
628 gaattcataactcaattcaatcaatatgtaattattttaatacttttcataagtagcaccagaataaatattaatagcaccacaaattaaggtaagcaca 727  Q
    ||||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
8103743 gaattcataactcaattcaatcaatatatgattattttgatacttttcataagtagcaccagaataaatattaatagcaccacaaattaagataagcaca 8103842  T
728 aaactttttaaaattttggttcttcctaatttgcaactagtgtattttcccttttgcagcttaaaccaaacaataataatatagaaggattatatatagt 827  Q
    |||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8103843 aaactttttaaaattttgattcttggtaatttgcaactagtgtattttcccttttgcagcttaaaccaaacaataataatatagaaggattatatatagt 8103942  T
828 actgctgaagttaaatcat---aacgctattgcatataatataaacacgacttgacttcttaacattacttggtcgtgaaacct 908  Q
    |||| ||||||||||| ||   ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
8103943 actgttgaagttaaattattacaacactattgcatataatataaacacgacttgacttcttaacattacttgatcgtgaaacct 8104026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 171; E-Value: 4e-91
Query Start/End: Original strand, 628 - 826
Target Start/End: Original strand, 8102245 - 8102443
Alignment:
628 gaattcataactcaattcaatcaatatgtaattattttaatacttttcataagtagcaccagaataaatattaatagcaccacaaattaaggtaagcaca 727  Q
    ||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
8102245 gaattcataactcaattcaatcaatatataattattttgatatttttcataagtagcaccagaataaatattaatagcaccacaaattaagataagcaca 8102344  T
728 aaactttttaaaattttggttcttcctaatttgcaactagtgtattttcccttttgcagcttaaaccaaacaataataatatagaaggattatatatag 826  Q
    |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
8102345 aaactttttaaaattttgattcttcgtaatttgcaactagtgtattttcccttttgcagcttaaaccaaacgataataatatagaaggattatatatag 8102443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 130; E-Value: 1e-66
Query Start/End: Original strand, 628 - 793
Target Start/End: Complemental strand, 8099649 - 8099484
Alignment:
628 gaattcataactcaattcaatcaatatgtaattattttaatacttttcataagtagcaccagaataaatattaatagcaccacaaattaaggtaagcaca 727  Q
    |||||||  |||||||||||||||||||| |||||||| ||| |||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||    
8099649 gaattcaacactcaattcaatcaatatgtgattattttgatatttttcataagtagcaccaaaataaatattaatagcaccataaattaagataagcaca 8099550  T
728 aaactttttaaaattttggttcttcctaatttgcaactagtgtattttcccttttgcagcttaaac 793  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
8099549 aaactttttaaaattttggttcttcgtaatttgcaactagtgtattttcccttttgcagcttaaac 8099484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.00000000000004
Query Start/End: Original strand, 594 - 635
Target Start/End: Original strand, 8105049 - 8105090
Alignment:
594 taagtgatgatggagtagaatattggttgttaaagaattcat 635  Q
    ||||||||||||||||||||||||||||||||||||||||||    
8105049 taagtgatgatggagtagaatattggttgttaaagaattcat 8105090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.0000000000002
Query Start/End: Original strand, 62 - 106
Target Start/End: Original strand, 8104977 - 8105021
Alignment:
62 gctgttctggctacatatgcaagttctgtcagagtagctgtaaca 106  Q
    ||||||||||||||||||||||||||||| |||||||||||||||    
8104977 gctgttctggctacatatgcaagttctgtgagagtagctgtaaca 8105021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 169
Target Start/End: Original strand, 8105019 - 8105052
Alignment:
136 acattaattggtaatgactttaaagcctactaag 169  Q
    ||||||||||||||||||||||||||||||||||    
8105019 acattaattggtaatgactttaaagcctactaag 8105052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000004
Query Start/End: Original strand, 1216 - 1251
Target Start/End: Complemental strand, 8100407 - 8100372
Alignment:
1216 attttgattgtgcttattgttagttatattaatttt 1251  Q
    ||||| ||||||||||||||||||||||||||||||    
8100407 attttcattgtgcttattgttagttatattaatttt 8100372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 54; Significance: 3e-21; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-21
Query Start/End: Original strand, 738 - 823
Target Start/End: Original strand, 21261245 - 21261329
Alignment:
738 aaattttggttcttcctaatttgcaactagtgtattttcccttttgcagcttaaaccaaacaataataatatagaaggattatata 823  Q
    ||||||||||||| | |||||||||||||||||||||| ||||| |||| |||||||||||||||||||||| |||| ||||||||    
21261245 aaattttggttctgcataatttgcaactagtgtatttt-cctttggcagattaaaccaaacaataataatatcgaagaattatata 21261329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000004
Query Start/End: Original strand, 702 - 776
Target Start/End: Complemental strand, 13779817 - 13779742
Alignment:
702 tagcaccacaaattaaggtaagcacaaaactttttaaaattttggttct-tcctaatttgcaactagtgtattttc 776  Q
    ||||||||||||||||| |||| ||||||| |||| |||||| ||||||  | |||||||||||||  ||||||||    
13779817 tagcaccacaaattaagataagaacaaaacatttttaaatttcggttctggcataatttgcaactacagtattttc 13779742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 702 - 811
Target Start/End: Original strand, 35033429 - 35033538
Alignment:
702 tagcaccacaaattaaggtaagcacaaaactttttaaaattttggttct-tcctaatttgcaactagtgtattttcccttttgcagcttaaaccaaacaa 800  Q
    ||||||||||||||||| |||| ||||||| |||| |||||| ||||||  | |||||||||||||  ||| ||||  |||  ||| |||||  ||||||    
35033429 tagcaccacaaattaagataagaacaaaacatttttaaatttcggttctgacataatttgcaactacagta-tttctatttgtcaggttaaataaaacaa 35033527  T
801 taataatatag 811  Q
    |||||||||||    
35033528 taataatatag 35033538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 7e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 7e-19
Query Start/End: Original strand, 679 - 748
Target Start/End: Complemental strand, 42957833 - 42957764
Alignment:
679 agtagcaccagaataaatattaatagcaccacaaattaaggtaagcacaaaactttttaaaattttggtt 748  Q
    |||||||||| |||||| ||||||||||||||||||||||||||| ||||||| |||| |||||||||||    
42957833 agtagcaccataataaacattaatagcaccacaaattaaggtaagaacaaaacatttttaaattttggtt 42957764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 702 - 811
Target Start/End: Original strand, 28198770 - 28198879
Alignment:
702 tagcaccacaaattaaggtaagcacaaaactttttaaaattttggttct-tcctaatttgcaactagtgtattttcccttttgcagcttaaaccaaacaa 800  Q
    ||||||||||||||||| |||| ||||||| |||| |||||| ||||||  | |||||||||||||   || ||||| |||  ||| |||||  ||||||    
28198770 tagcaccacaaattaagataagaacaaaacatttttaaatttcggttctggcataatttgcaactacaata-tttccatttgtcaggttaaataaaacaa 28198868  T
801 taataatatag 811  Q
    |||||||||||    
28198869 taataatatag 28198879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 312364 times since January 2019
Visitors: 445