View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk23-10 (Length: 425)

Name: R108-tnk23-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk23-10
R108-tnk23-10
[»] chr4 (8 HSPs)
chr4 (1-425)||(22690081-22690503)
chr4 (1-418)||(22721520-22721921)
chr4 (40-418)||(22749168-22749522)
chr4 (353-418)||(22768414-22768479)
chr4 (353-418)||(22923452-22923517)
chr4 (353-418)||(22928105-22928170)
chr4 (353-418)||(22984384-22984449)
chr4 (353-418)||(22997972-22998037)


Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 425
Target Start/End: Complemental strand, 22690503 - 22690081
Alignment:
1 tctagagcattgtcttgaagtttcaaattaaatgtcatgttttcccgtaaaaaagatgcctatctactcaccagattctattacacaaaactccaagctt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
22690503 tctagagcattgtcttgaagtttcaaattaaatgtcatgttttcccgtaaaaaagatgcctatctactca-cagattctattacacaaaactccaagctt 22690405  T
101 cttctgaggtgaacgtgccaaagaagctagatgcagttgctggaacgaaatcagtc----tatgatcaacattttgattgggtattgttgtggaacatcg 196  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||     |||||||||||||||||| ||||||||||||||||||||    
22690404 cttctgaggtgaacgtg-caaagaagctagatgcagttgctggaacgaaatcagtcgaataatgatcaacattttgatt-ggtattgttgtggaacatcg 22690307  T
197 ctagaattatccatagataccaagttcctcgctttctttattttcttcttctttgggtatcagacctgaggg-aaaaaatggacagaaaagtgaaaccag 295  Q
    ||||||||||||||||||| |||||||||||||||||||  ||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||    
22690306 ctagaattatccatagata-caagttcctcgctttctttgatttcttcttcttt-ggtatcagacctgagggaaaaaaatggacag-aaagtgaaaccag 22690210  T
296 tacttaatacttagacaaggaaaacgtnnnnnnnnnnnntgaattataaatacaagcatacacgcatggagcaacatacgctatttgtttaacaaattgt 395  Q
    |||||||||||||||||||| ||| ||            ||||| ||||||||||||||  |   |||||||||||||| ||||||||||||||||||||    
22690209 tacttaatacttagacaagg-aaatgtaaaaatataaaatgaatgataaatacaagcatggagtgatggagcaacatacactatttgtttaacaaattgt 22690111  T
396 cccctaacacgtggccgctgatccgccaat 425  Q
    ||||||||||||||||||||||| ||||||    
22690110 cccctaacacgtggccgctgatctgccaat 22690081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 418
Target Start/End: Complemental strand, 22721921 - 22721520
Alignment:
1 tctagagcattgtcttgaagtttcaaattaaatgtcatgttttcc-cgtaaaaaagatgcctatctactcaccagattct---attacacaaaactccaa 96  Q
    ||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||| |||||||| |||||||   |||||||||||||||||    
22721921 tctagagcattgtcttgaagtttcaaattgaatgtcatgtttttcacgtaaaaaagatgcctacctactcac-agattcttctattacacaaaactccaa 22721823  T
97 gcttcttctgaggtgaacgtgccaaagaagctagatgcagttgctggaacgaaatcagtcta----tgatcaacattttgattgggtattgttgtggaac 192  Q
    |||||||| |||||||||||||  |  || |||||||||||| ||||||| ||||||||| |    |||||| |||||            ||||||||||    
22721822 gcttcttccgaggtgaacgtgcagagaaaactagatgcagttactggaacaaaatcagtcgaataatgatcaccattt------------gttgtggaac 22721735  T
193 atcgctagaattatccatagataccaagttcctcgctttctttattttcttcttctttgggtatcagacctga-gggaaaaaatggacagaaaagtgaaa 291  Q
    |||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |||||||||    
22721734 atcgctagaattattcatagatac-aagttcctcactttctttattttcttcttcttt-ggtatcagacctgaggggaaaaaatggacag-aaagtgaaa 22721638  T
292 ccagtacttaatacttagacaaggaaaacgtnnnnnnnnnnnntgaattataaatacaagcatacacgcatggagcaacatacgctatttgtttaacaaa 391  Q
    | |||| ||||||||||||||||| |||| |             |||| ||||||||||        ||||||||||||||||  |||||||||||||||    
22721637 ctagtagttaatacttagacaagg-aaacataaaaatataaaacgaatgataaatacaa--------gcatggagcaacatacagtatttgtttaacaaa 22721547  T
392 ttgtcccctaacacgtggccgctgatc 418  Q
    ||||||||||||| |||||||||||||    
22721546 ttgtcccctaacatgtggccgctgatc 22721520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 40 - 418
Target Start/End: Complemental strand, 22749522 - 22749168
Alignment:
40 ttttcccgtaaaaaagatgcctatctactcaccagattct---attacacaaaactccaagcttcttctgaggtgaacgtgccaaagaagctagatgcag 136  Q
    ||||| |||| |||||||||||| |||||||| |||||||   ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||    
22749522 ttttcacgtagaaaagatgcctacctactcac-agattcttctattacacaaaactccaagcttcttctggggtgaacgtgc-aaagaagctagatgcag 22749425  T
137 ttgctggaacgaaatcagtctatgatcaacattttgattgggtattgttgtggaacatcgctagaattatccatagataccaagttcctcgctttcttta 236  Q
    |        |  ||| |     |||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||    
22749424 t--------cagaataa-----tgatcagcattttgattgg-tattgttgtggaacatcgctagaattattcatagatac-aagttcctcgctttcttta 22749340  T
237 ttttcttcttctttgggtatcagacctga-gggaaaaaatggacagaaaagtgaaaccagtacttaatacttagacaaggaaaacgtnnnnnnnnnnnnt 335  Q
    |||||||||||||| |||||||||||||| |||||||||||||||| |||||||||| |||| ||||||||||||||||| |||| |                 
22749339 ttttcttcttcttt-ggtatcagacctgaggggaaaaaatggacag-aaagtgaaactagtagttaatacttagacaagg-aaacataaaaatataaaac 22749243  T
336 gaattataaatacaagcatacacgcatggagcaacatacgctatttgtttaacaaattgtcccctaacacgtggccgctgatc 418  Q
    |||| ||||||||||        |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
22749242 gaatgataaatacaa--------gcatggagcaacatacactatttgtttaacaaattatcccctaacacgtggccgctgatc 22749168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 353 - 418
Target Start/End: Complemental strand, 22768479 - 22768414
Alignment:
353 atacacgcatggagcaacatacgctatttgtttaacaaattgtcccctaacacgtggccgctgatc 418  Q
    ||||| |||| ||||||||||| |||||||||||||||||| |||||||||| ||||||| |||||    
22768479 atacaagcatcgagcaacatacactatttgtttaacaaattttcccctaacaagtggccgttgatc 22768414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 418
Target Start/End: Original strand, 22923452 - 22923517
Alignment:
353 atacacgcatggagcaacatacgctatttgtttaacaaattgtcccctaacacgtggccgctgatc 418  Q
    ||||| |||||||| ||||||| || |||||||||||||||||||| | |||||||| || |||||    
22923452 atacaagcatggagaaacatacactgtttgtttaacaaattgtcccttgacacgtggtcgttgatc 22923517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 418
Target Start/End: Original strand, 22928105 - 22928170
Alignment:
353 atacacgcatggagcaacatacgctatttgtttaacaaattgtcccctaacacgtggccgctgatc 418  Q
    ||||| |||||||| ||||||| || |||||||||||||||||||| | |||||||| || |||||    
22928105 atacaagcatggagaaacatacactgtttgtttaacaaattgtcccttgacacgtggtcgttgatc 22928170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 418
Target Start/End: Original strand, 22984384 - 22984449
Alignment:
353 atacacgcatggagcaacatacgctatttgtttaacaaattgtcccctaacacgtggccgctgatc 418  Q
    ||||| |||||||| ||||||| || |||||||||||||||||||| | |||||||| || |||||    
22984384 atacaagcatggagaaacatacactgtttgtttaacaaattgtcccttgacacgtggtcgttgatc 22984449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 353 - 418
Target Start/End: Original strand, 22997972 - 22998037
Alignment:
353 atacacgcatggagcaacatacgctatttgtttaacaaattgtcccctaacacgtggccgctgatc 418  Q
    ||||| |||||||| ||||||| || |||||||||||||||||||| | |||||||| || |||||    
22997972 atacaagcatggagaaacatacactgtttgtttaacaaattgtcccttgacacgtggtcgttgatc 22998037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105958 times since January 2019
Visitors: 1319