View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk23-3 (Length: 557)

Name: R108-tnk23-3
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk23-3
R108-tnk23-3
[»] chr2 (102 HSPs)
chr2 (394-557)||(15866341-15866504)
chr2 (140-292)||(18179172-18179323)
chr2 (137-227)||(15866665-15866754)
chr2 (132-257)||(33942129-33942255)
chr2 (138-292)||(5759507-5759660)
chr2 (133-215)||(22681194-22681275)
chr2 (150-292)||(32821806-32821947)
chr2 (132-292)||(33256719-33256875)
chr2 (132-292)||(43141850-43142010)
chr2 (138-250)||(9556224-9556335)
chr2 (132-292)||(10285839-10285998)
chr2 (186-306)||(18884899-18885019)
chr2 (132-292)||(40158697-40158856)
chr2 (134-292)||(8017415-8017572)
chr2 (140-214)||(13736303-13736376)
chr2 (187-292)||(16503385-16503491)
chr2 (130-292)||(28933801-28933961)
chr2 (153-265)||(11488277-11488386)
chr2 (132-292)||(11513877-11514034)
chr2 (186-275)||(44606059-44606148)
chr2 (134-214)||(9395111-9395190)
chr2 (186-254)||(15120215-15120283)
chr2 (132-292)||(17221472-17221631)
chr2 (134-241)||(18066109-18066216)
chr2 (220-292)||(22878164-22878236)
chr2 (221-292)||(3973609-3973680)
chr2 (138-257)||(5452312-5452429)
chr2 (157-292)||(33192206-33192339)
chr2 (177-292)||(43529790-43529904)
chr2 (359-397)||(15866627-15866665)
chr2 (186-292)||(43985241-43985347)
chr2 (203-256)||(4550796-4550849)
chr2 (132-257)||(6993691-6993815)
chr2 (136-292)||(15377748-15377903)
chr2 (134-175)||(25800810-25800851)
chr2 (187-292)||(27237825-27237930)
chr2 (145-257)||(1741999-1742110)
chr2 (150-230)||(1939326-1939404)
chr2 (139-243)||(12215793-12215896)
chr2 (140-291)||(30552576-30552727)
chr2 (197-292)||(787375-787470)
chr2 (192-271)||(5902502-5902581)
chr2 (49-120)||(10150651-10150722)
chr2 (186-257)||(11063520-11063591)
chr2 (186-285)||(16551779-16551878)
chr2 (187-270)||(29429711-29429794)
chr2 (186-285)||(41809184-41809283)
chr2 (167-241)||(1647250-1647323)
chr2 (153-275)||(10567057-10567178)
chr2 (163-257)||(19629373-19629464)
chr2 (134-255)||(26626854-26626975)
chr2 (132-233)||(29633051-29633152)
chr2 (140-214)||(39983329-39983402)
chr2 (171-253)||(40672781-40672862)
chr2 (187-292)||(9996771-9996876)
chr2 (190-291)||(13866914-13867015)
chr2 (138-259)||(18962002-18962123)
chr2 (140-252)||(938482-938593)
chr2 (197-257)||(14316112-14316172)
chr2 (240-292)||(15200265-15200317)
chr2 (220-292)||(25609862-25609934)
chr2 (208-292)||(28803462-28803546)
chr2 (197-257)||(32098297-32098357)
chr2 (163-243)||(34652017-34652096)
chr2 (188-272)||(43456659-43456743)
chr2 (218-274)||(43808622-43808678)
chr2 (129-228)||(656773-656871)
chr2 (134-292)||(1625881-1626038)
chr2 (186-253)||(1830077-1830144)
chr2 (187-274)||(3067329-3067416)
chr2 (152-215)||(9174814-9174876)
chr2 (202-269)||(9878637-9878704)
chr2 (152-215)||(10884530-10884592)
chr2 (186-289)||(13234538-13234641)
chr2 (197-292)||(29430801-29430896)
chr2 (233-288)||(34927042-34927097)
chr2 (146-273)||(35485910-35486036)
chr2 (137-172)||(42592323-42592358)
chr2 (197-268)||(43811153-43811224)
chr2 (134-228)||(680484-680577)
chr2 (138-256)||(5133757-5133874)
chr2 (134-251)||(10563533-10563647)
chr2 (164-250)||(17380578-17380664)
chr2 (187-292)||(17775398-17775503)
chr2 (163-257)||(19826274-19826365)
chr2 (134-228)||(29316771-29316864)
chr2 (218-271)||(1318300-1318353)
chr2 (190-255)||(1494415-1494480)
chr2 (132-292)||(7103405-7103574)
chr2 (140-225)||(10198479-10198563)
chr2 (186-259)||(28677624-28677697)
chr2 (186-251)||(43635074-43635139)
chr2 (186-230)||(1056123-1056167)
chr2 (186-270)||(8820246-8820330)
chr2 (163-251)||(9530702-9530788)
chr2 (186-246)||(10285387-10285447)
chr2 (195-255)||(11344739-11344799)
chr2 (220-292)||(14277825-14277897)
chr2 (190-257)||(16451154-16451222)
chr2 (163-247)||(35378993-35379076)
chr2 (186-269)||(38388718-38388802)
chr2 (236-292)||(42852634-42852690)
[»] chr4 (87 HSPs)
chr4 (394-523)||(53077738-53077867)
chr4 (132-292)||(2996552-2996711)
chr4 (132-292)||(21157747-21157906)
chr4 (132-292)||(24091442-24091601)
chr4 (201-292)||(27725261-27725352)
chr4 (185-292)||(4691879-4691986)
chr4 (142-257)||(11264290-11264404)
chr4 (130-289)||(28232522-28232680)
chr4 (138-292)||(44319934-44320087)
chr4 (146-255)||(6978931-6979039)
chr4 (134-256)||(17884049-17884174)
chr4 (222-291)||(18628486-18628555)
chr4 (147-255)||(1137706-1137813)
chr4 (140-292)||(53315313-53315464)
chr4 (132-271)||(7693964-7694101)
chr4 (132-255)||(10192263-10192388)
chr4 (193-292)||(19304965-19305064)
chr4 (130-213)||(30207582-30207664)
chr4 (132-257)||(7368021-7368147)
chr4 (167-257)||(19394730-19394819)
chr4 (138-240)||(24929478-24929579)
chr4 (186-292)||(33534101-33534207)
chr4 (218-291)||(8328052-8328125)
chr4 (186-271)||(42461283-42461368)
chr4 (135-215)||(8468930-8469009)
chr4 (131-251)||(46415765-46415884)
chr4 (134-253)||(50800001-50800118)
chr4 (186-257)||(6987708-6987779)
chr4 (153-268)||(9680671-9680785)
chr4 (132-292)||(24370883-24371044)
chr4 (197-292)||(25583635-25583730)
chr4 (130-253)||(45128281-45128403)
chr4 (201-292)||(50298563-50298653)
chr4 (163-257)||(4798533-4798626)
chr4 (163-257)||(21043202-21043295)
chr4 (167-245)||(28614787-28614864)
chr4 (136-257)||(29263353-29263474)
chr4 (186-292)||(47970328-47970434)
chr4 (208-257)||(19429479-19429528)
chr4 (134-214)||(20031730-20031810)
chr4 (130-175)||(20907324-20907369)
chr4 (186-292)||(25896812-25896922)
chr4 (218-271)||(27123305-27123358)
chr4 (130-175)||(36823976-36824020)
chr4 (201-294)||(41097187-41097279)
chr4 (130-291)||(43824260-43824420)
chr4 (187-292)||(45927382-45927487)
chr4 (197-270)||(46797057-46797130)
chr4 (134-239)||(52746825-52746929)
chr4 (51-115)||(7730513-7730577)
chr4 (203-251)||(21952997-21953045)
chr4 (138-214)||(36048518-36048593)
chr4 (134-174)||(40174544-40174584)
chr4 (131-271)||(42866046-42866185)
chr4 (132-172)||(53626755-53626795)
chr4 (132-215)||(11802513-11802595)
chr4 (187-274)||(18011904-18011991)
chr4 (49-120)||(19422314-19422385)
chr4 (221-292)||(25717660-25717731)
chr4 (136-215)||(30066775-30066853)
chr4 (136-175)||(35571679-35571718)
chr4 (132-215)||(49219118-49219200)
chr4 (218-292)||(6428082-6428156)
chr4 (238-292)||(28615608-28615662)
chr4 (130-184)||(35517172-35517226)
chr4 (138-172)||(36460571-36460605)
chr4 (134-212)||(53294126-53294203)
chr4 (134-203)||(437453-437521)
chr4 (187-292)||(3176036-3176141)
chr4 (130-183)||(19154723-19154776)
chr4 (132-241)||(20936212-20936320)
chr4 (132-257)||(23819068-23819192)
chr4 (153-246)||(27721717-27721809)
chr4 (140-209)||(29601023-29601091)
chr4 (187-292)||(51560221-51560326)
chr4 (134-175)||(51630092-51630133)
chr4 (142-214)||(6364138-6364209)
chr4 (232-292)||(9316603-9316663)
chr4 (136-292)||(10172045-10172200)
chr4 (145-289)||(14011226-14011369)
chr4 (232-288)||(20521581-20521637)
chr4 (132-160)||(21952940-21952968)
chr4 (236-292)||(25487489-25487545)
chr4 (187-243)||(28749888-28749944)
chr4 (220-292)||(29375969-29376041)
chr4 (134-174)||(29778776-29778816)
chr4 (236-292)||(46860000-46860056)
[»] chr6 (64 HSPs)
chr6 (132-274)||(281798-281939)
chr6 (138-255)||(4247030-4247146)
chr6 (132-292)||(8420129-8420288)
chr6 (186-272)||(9027610-9027696)
chr6 (218-292)||(30865547-30865621)
chr6 (136-292)||(28088155-28088309)
chr6 (197-292)||(30863289-30863384)
chr6 (198-292)||(1669730-1669824)
chr6 (138-244)||(4246395-4246500)
chr6 (134-251)||(9093528-9093645)
chr6 (218-292)||(24973959-24974033)
chr6 (134-208)||(31671090-31671163)
chr6 (132-270)||(32386517-32386654)
chr6 (163-292)||(2455820-2455948)
chr6 (140-281)||(10616485-10616624)
chr6 (144-292)||(7148657-7148804)
chr6 (187-251)||(34404698-34404762)
chr6 (188-251)||(821833-821896)
chr6 (132-251)||(4006693-4006811)
chr6 (138-257)||(8035115-8035233)
chr6 (141-292)||(32171455-32171605)
chr6 (203-270)||(32917246-32917313)
chr6 (132-238)||(6647366-6647471)
chr6 (135-257)||(8364943-8365064)
chr6 (201-271)||(27595520-27595590)
chr6 (130-215)||(24782036-24782120)
chr6 (132-230)||(3155155-3155251)
chr6 (140-271)||(34403842-34403972)
chr6 (164-291)||(34939755-34939881)
chr6 (146-288)||(769132-769272)
chr6 (130-184)||(2727895-2727949)
chr6 (145-247)||(8183137-8183238)
chr6 (186-292)||(32171315-32171421)
chr6 (222-292)||(32848528-32848598)
chr6 (199-292)||(733109-733202)
chr6 (218-271)||(2460104-2460157)
chr6 (132-169)||(5550111-5550148)
chr6 (148-272)||(10476074-10476196)
chr6 (186-259)||(20368145-20368218)
chr6 (219-292)||(27857423-27857496)
chr6 (187-292)||(34939546-34939651)
chr6 (134-226)||(415285-415376)
chr6 (138-206)||(1275134-1275201)
chr6 (140-244)||(2117390-2117493)
chr6 (132-184)||(14492281-14492333)
chr6 (135-175)||(24838791-24838831)
chr6 (199-271)||(32976023-32976095)
chr6 (218-257)||(2027765-2027804)
chr6 (186-245)||(4420675-4420734)
chr6 (148-251)||(28641722-28641824)
chr6 (132-171)||(29274281-29274320)
chr6 (235-274)||(33067239-33067278)
chr6 (187-274)||(2167106-2167195)
chr6 (187-274)||(2178739-2178828)
chr6 (163-293)||(7931657-7931786)
chr6 (143-228)||(3168257-3168341)
chr6 (130-175)||(5730678-5730723)
chr6 (138-175)||(7446379-7446416)
chr6 (167-288)||(29957858-29957978)
chr6 (188-253)||(32577957-32578022)
chr6 (218-251)||(34404604-34404637)
chr6 (197-257)||(2767716-2767776)
chr6 (132-160)||(22742345-22742373)
chr6 (132-208)||(33787761-33787836)
[»] chr3 (76 HSPs)
chr3 (135-305)||(36646301-36646470)
chr3 (134-292)||(41724192-41724350)
chr3 (130-292)||(2923455-2923616)
chr3 (132-292)||(37273110-37273272)
chr3 (420-529)||(50273442-50273551)
chr3 (130-266)||(14548679-14548814)
chr3 (132-291)||(33965421-33965582)
chr3 (134-251)||(1217773-1217889)
chr3 (145-282)||(43115048-43115184)
chr3 (132-239)||(1816562-1816668)
chr3 (134-257)||(21574472-21574593)
chr3 (137-242)||(22214641-22214745)
chr3 (132-292)||(11253481-11253639)
chr3 (140-292)||(27290833-27290984)
chr3 (139-282)||(20192548-20192690)
chr3 (134-256)||(21367648-21367770)
chr3 (197-272)||(24624253-24624328)
chr3 (201-288)||(27294393-27294480)
chr3 (132-271)||(38462260-38462397)
chr3 (201-272)||(52323846-52323917)
chr3 (218-292)||(10540425-10540499)
chr3 (197-274)||(50004695-50004773)
chr3 (147-257)||(50600145-50600254)
chr3 (138-235)||(3044248-3044344)
chr3 (232-292)||(22667481-22667541)
chr3 (232-292)||(22724120-22724180)
chr3 (218-305)||(21872214-21872301)
chr3 (132-239)||(24887269-24887374)
chr3 (197-292)||(31710819-31710914)
chr3 (197-292)||(31711074-31711169)
chr3 (138-208)||(20502084-20502153)
chr3 (132-246)||(23785234-23785347)
chr3 (201-271)||(24603705-24603775)
chr3 (146-292)||(30573847-30573991)
chr3 (137-175)||(33405215-33405253)
chr3 (186-292)||(45541603-45541709)
chr3 (165-306)||(24785273-24785413)
chr3 (163-288)||(30923835-30923958)
chr3 (156-253)||(31010405-31010501)
chr3 (129-170)||(33306776-33306817)
chr3 (134-215)||(36783343-36783423)
chr3 (132-292)||(43875627-43875788)
chr3 (224-305)||(50211805-50211886)
chr3 (134-227)||(52618984-52619076)
chr3 (132-255)||(2201107-2201236)
chr3 (186-275)||(16790326-16790416)
chr3 (135-175)||(20874352-20874392)
chr3 (132-204)||(23315605-23315676)
chr3 (189-277)||(27787046-27787134)
chr3 (145-257)||(40880915-40881026)
chr3 (197-257)||(49772635-49772695)
chr3 (146-245)||(3015822-3015920)
chr3 (147-254)||(14598523-14598628)
chr3 (225-292)||(24158448-24158515)
chr3 (137-176)||(41057022-41057061)
chr3 (48-114)||(4534465-4534531)
chr3 (134-292)||(20669600-20669756)
chr3 (163-257)||(45535187-45535278)
chr3 (148-253)||(20467157-20467261)
chr3 (153-226)||(20669172-20669244)
chr3 (239-292)||(30657371-30657424)
chr3 (146-251)||(39602183-39602287)
chr3 (197-254)||(42817192-42817249)
chr3 (140-209)||(48807695-48807763)
chr3 (193-269)||(2175804-2175880)
chr3 (224-292)||(4534307-4534375)
chr3 (197-257)||(11039306-11039366)
chr3 (145-292)||(20173822-20173966)
chr3 (138-178)||(22343593-22343633)
chr3 (236-292)||(25699130-25699186)
chr3 (186-230)||(25925774-25925818)
chr3 (220-292)||(27792938-27793010)
chr3 (132-272)||(41452502-41452641)
chr3 (153-289)||(41644380-41644515)
chr3 (130-170)||(52440715-52440755)
chr3 (134-182)||(53891934-53891982)
[»] chr1 (105 HSPs)
chr1 (134-292)||(31517672-31517829)
chr1 (132-270)||(44422678-44422815)
chr1 (140-292)||(10199340-10199491)
chr1 (132-257)||(25479560-25479684)
chr1 (140-292)||(15581241-15581392)
chr1 (396-530)||(1459455-1459589)
chr1 (130-271)||(15579459-15579599)
chr1 (140-292)||(4622080-4622231)
chr1 (132-292)||(6292472-6292630)
chr1 (132-292)||(7218006-7218165)
chr1 (203-271)||(15709898-15709966)
chr1 (132-254)||(25005765-25005888)
chr1 (133-292)||(6279379-6279537)
chr1 (153-292)||(27140478-27140616)
chr1 (186-292)||(37593616-37593722)
chr1 (141-207)||(41638508-41638574)
chr1 (132-289)||(28467244-28467398)
chr1 (138-292)||(4549473-4549627)
chr1 (140-255)||(16322836-16322950)
chr1 (186-257)||(38170657-38170728)
chr1 (153-271)||(11639369-11639486)
chr1 (188-257)||(11941296-11941366)
chr1 (201-291)||(32515374-32515464)
chr1 (186-256)||(38867799-38867869)
chr1 (142-248)||(39270401-39270506)
chr1 (187-288)||(601074-601174)
chr1 (132-229)||(3224402-3224498)
chr1 (187-292)||(3597213-3597318)
chr1 (132-253)||(17269229-17269349)
chr1 (132-292)||(30257662-30257822)
chr1 (395-523)||(1499153-1499281)
chr1 (132-292)||(10439665-10439824)
chr1 (232-292)||(14741567-14741627)
chr1 (132-244)||(17628578-17628689)
chr1 (164-292)||(26461873-26462000)
chr1 (147-222)||(5090856-5090930)
chr1 (130-253)||(11695838-11695960)
chr1 (141-292)||(12564431-12564581)
chr1 (132-175)||(25006082-25006125)
chr1 (139-255)||(28689421-28689538)
chr1 (134-260)||(4549211-4549336)
chr1 (218-292)||(4757402-4757476)
chr1 (186-292)||(4868432-4868537)
chr1 (218-292)||(18327078-18327152)
chr1 (218-292)||(23373245-23373319)
chr1 (132-174)||(49517049-49517091)
chr1 (142-292)||(3215710-3215860)
chr1 (203-292)||(6976973-6977062)
chr1 (134-215)||(9656631-9656711)
chr1 (219-292)||(26679419-26679492)
chr1 (132-177)||(27738226-27738271)
chr1 (218-267)||(28467497-28467546)
chr1 (218-307)||(43420322-43420411)
chr1 (201-270)||(44928145-44928214)
chr1 (135-215)||(5592694-5592773)
chr1 (132-184)||(15361692-15361744)
chr1 (186-270)||(26678673-26678757)
chr1 (208-292)||(28837285-28837368)
chr1 (132-215)||(6659493-6659575)
chr1 (134-209)||(7472292-7472366)
chr1 (140-215)||(23902076-23902150)
chr1 (197-292)||(27807158-27807253)
chr1 (132-171)||(30371127-30371166)
chr1 (137-292)||(33976163-33976316)
chr1 (197-292)||(45327623-45327718)
chr1 (132-254)||(4548700-4548821)
chr1 (222-292)||(5157140-5157210)
chr1 (197-251)||(6262781-6262835)
chr1 (129-175)||(6602341-6602387)
chr1 (133-175)||(12564922-12564964)
chr1 (208-289)||(17631039-17631118)
chr1 (138-228)||(21012775-21012864)
chr1 (140-202)||(37241844-37241905)
chr1 (218-272)||(40485725-40485779)
chr1 (218-292)||(41853861-41853935)
chr1 (200-254)||(50319075-50319129)
chr1 (153-215)||(51929784-51929845)
chr1 (197-250)||(3052680-3052733)
chr1 (190-255)||(4481966-4482031)
chr1 (132-185)||(5421958-5422011)
chr1 (163-240)||(24460391-24460467)
chr1 (41-173)||(29045962-29046095)
chr1 (138-271)||(43338101-43338233)
chr1 (186-227)||(47877141-47877182)
chr1 (140-185)||(48830114-48830159)
chr1 (224-292)||(1393020-1393088)
chr1 (135-175)||(7069283-7069323)
chr1 (163-267)||(7262475-7262578)
chr1 (152-252)||(10744300-10744399)
chr1 (169-237)||(20713672-20713739)
chr1 (153-257)||(23407431-23407534)
chr1 (132-175)||(23544687-23544731)
chr1 (199-271)||(26179516-26179588)
chr1 (197-225)||(28837044-28837072)
chr1 (199-255)||(29929590-29929646)
chr1 (132-271)||(30259439-30259578)
chr1 (148-220)||(35179134-35179205)
chr1 (138-170)||(37272639-37272671)
chr1 (197-257)||(38001639-38001699)
chr1 (130-170)||(40304107-40304147)
chr1 (197-257)||(42397768-42397828)
chr1 (237-285)||(44217454-44217502)
chr1 (145-292)||(49691985-49692128)
chr1 (135-211)||(49888749-49888824)
chr1 (163-255)||(52190139-52190230)
[»] chr8 (87 HSPs)
chr8 (132-292)||(12361171-12361332)
chr8 (153-286)||(11569395-11569527)
chr8 (187-292)||(30191073-30191178)
chr8 (132-306)||(9699980-9700153)
chr8 (136-255)||(30389082-30389200)
chr8 (132-254)||(6509273-6509394)
chr8 (163-257)||(14949876-14949969)
chr8 (140-292)||(44865498-44865647)
chr8 (200-292)||(4560548-4560640)
chr8 (146-257)||(31862486-31862595)
chr8 (163-253)||(9540967-9541056)
chr8 (138-228)||(11795077-11795166)
chr8 (142-292)||(39551141-39551290)
chr8 (135-292)||(11376685-11376841)
chr8 (141-238)||(31705073-31705169)
chr8 (140-253)||(40071736-40071848)
chr8 (163-255)||(4055585-4055676)
chr8 (132-292)||(8062503-8062662)
chr8 (132-272)||(11415133-11415272)
chr8 (134-241)||(4558779-4558885)
chr8 (153-292)||(8060669-8060806)
chr8 (140-271)||(28769292-28769422)
chr8 (138-292)||(7714227-7714380)
chr8 (232-290)||(24326109-24326167)
chr8 (186-290)||(21130646-21130748)
chr8 (197-274)||(26410323-26410400)
chr8 (132-292)||(38874625-38874785)
chr8 (163-292)||(44236755-44236883)
chr8 (167-271)||(20672764-20672867)
chr8 (404-472)||(26787383-26787451)
chr8 (132-184)||(34770871-34770923)
chr8 (197-292)||(2487940-2488035)
chr8 (143-246)||(11183535-11183637)
chr8 (145-292)||(18931230-18931376)
chr8 (187-250)||(25869240-25869303)
chr8 (198-292)||(34849147-34849242)
chr8 (197-292)||(39881653-39881748)
chr8 (132-255)||(42215275-42215397)
chr8 (153-259)||(5069697-5069802)
chr8 (186-292)||(6950354-6950460)
chr8 (133-175)||(9834837-9834879)
chr8 (186-252)||(11118969-11119035)
chr8 (132-257)||(28784760-28784886)
chr8 (188-257)||(32840952-32841022)
chr8 (186-292)||(33553272-33553378)
chr8 (201-292)||(43709309-43709402)
chr8 (204-257)||(7918413-7918466)
chr8 (146-215)||(8062322-8062390)
chr8 (135-256)||(10114471-10114594)
chr8 (239-292)||(11059661-11059714)
chr8 (163-292)||(26479795-26479923)
chr8 (146-215)||(27028824-27028892)
chr8 (153-234)||(30277235-30277315)
chr8 (186-255)||(31875564-31875633)
chr8 (208-265)||(43393731-43393788)
chr8 (248-292)||(3634616-3634660)
chr8 (219-271)||(4181450-4181502)
chr8 (135-175)||(7514560-7514600)
chr8 (186-254)||(8558692-8558760)
chr8 (140-212)||(10075563-10075634)
chr8 (134-178)||(30043791-30043835)
chr8 (197-257)||(32156971-32157031)
chr8 (419-486)||(974943-975010)
chr8 (134-256)||(10120737-10120859)
chr8 (132-175)||(30013197-30013240)
chr8 (203-254)||(30987961-30988012)
chr8 (135-257)||(39268470-39268592)
chr8 (132-174)||(7645957-7645999)
chr8 (163-257)||(12851186-12851279)
chr8 (136-214)||(16210896-16210973)
chr8 (140-246)||(26473730-26473835)
chr8 (130-292)||(43504728-43504889)
chr8 (203-256)||(2093329-2093382)
chr8 (132-161)||(7878548-7878577)
chr8 (186-271)||(13000377-13000462)
chr8 (134-171)||(35374425-35374462)
chr8 (132-241)||(38537570-38537678)
chr8 (132-176)||(1640398-1640442)
chr8 (236-292)||(1889067-1889123)
chr8 (132-257)||(5088827-5088955)
chr8 (186-289)||(6496826-6496927)
chr8 (203-271)||(9572919-9572987)
chr8 (150-214)||(11745662-11745725)
chr8 (135-175)||(31884576-31884616)
chr8 (163-227)||(35220720-35220783)
chr8 (218-258)||(37461206-37461246)
chr8 (232-272)||(44168630-44168670)
[»] chr7 (72 HSPs)
chr7 (134-292)||(48157052-48157209)
chr7 (132-274)||(21453273-21453413)
chr7 (167-253)||(27121565-27121649)
chr7 (133-215)||(38010694-38010775)
chr7 (134-292)||(40428536-40428693)
chr7 (186-292)||(44808190-44808296)
chr7 (138-271)||(46082019-46082153)
chr7 (188-251)||(3500940-3501003)
chr7 (163-289)||(7244690-7244816)
chr7 (197-292)||(33894670-33894765)
chr7 (197-292)||(36598288-36598383)
chr7 (132-185)||(28340882-28340935)
chr7 (132-289)||(34754745-34754900)
chr7 (143-271)||(20553093-20553220)
chr7 (140-290)||(33645894-33646044)
chr7 (132-271)||(28165070-28165208)
chr7 (139-257)||(4966142-4966259)
chr7 (190-288)||(25670522-25670620)
chr7 (132-268)||(5369649-5369782)
chr7 (132-274)||(12110339-12110484)
chr7 (219-292)||(31341200-31341273)
chr7 (134-215)||(40688995-40689075)
chr7 (198-270)||(28520966-28521038)
chr7 (138-274)||(30535548-30535683)
chr7 (133-292)||(3610672-3610830)
chr7 (189-292)||(3836615-3836717)
chr7 (134-245)||(6263343-6263452)
chr7 (177-288)||(12234825-12234935)
chr7 (197-292)||(28727695-28727790)
chr7 (132-214)||(44821938-44822019)
chr7 (197-270)||(12834916-12834989)
chr7 (134-175)||(22759167-22759208)
chr7 (132-257)||(31338487-31338611)
chr7 (190-271)||(36537944-36538025)
chr7 (134-175)||(47177617-47177658)
chr7 (135-175)||(27548245-27548285)
chr7 (153-257)||(39334193-39334296)
chr7 (220-292)||(44178857-44178929)
chr7 (201-289)||(45078325-45078413)
chr7 (190-253)||(4001623-4001686)
chr7 (225-292)||(8427084-8427151)
chr7 (190-245)||(21247962-21248017)
chr7 (218-257)||(25422390-25422429)
chr7 (146-253)||(46104538-46104644)
chr7 (132-174)||(1417243-1417285)
chr7 (218-292)||(39542232-39542306)
chr7 (220-294)||(47007039-47007113)
chr7 (132-205)||(2012634-2012705)
chr7 (223-292)||(4970724-4970792)
chr7 (134-175)||(18350755-18350796)
chr7 (138-215)||(27378837-27378913)
chr7 (187-248)||(27517833-27517893)
chr7 (140-257)||(30553328-30553445)
chr7 (232-305)||(30751597-30751670)
chr7 (134-175)||(30812129-30812170)
chr7 (192-245)||(39539760-39539813)
chr7 (134-211)||(39907784-39907860)
chr7 (138-227)||(44151477-44151565)
chr7 (232-292)||(1418497-1418557)
chr7 (219-271)||(1431946-1431998)
chr7 (186-230)||(11048059-11048103)
chr7 (218-274)||(22387846-22387902)
chr7 (138-246)||(23434137-23434243)
chr7 (236-292)||(24048622-24048678)
chr7 (200-292)||(24909834-24909926)
chr7 (134-170)||(25296965-25297001)
chr7 (201-241)||(29290380-29290420)
chr7 (40-80)||(31341066-31341106)
chr7 (146-214)||(33673070-33673137)
chr7 (134-206)||(37064482-37064553)
chr7 (148-288)||(44615040-44615179)
chr7 (201-245)||(44686977-44687021)
[»] chr5 (88 HSPs)
chr5 (132-292)||(32172632-32172791)
chr5 (132-255)||(28586735-28586857)
chr5 (132-285)||(10272370-10272522)
chr5 (100-257)||(37526166-37526322)
chr5 (100-257)||(37588327-37588483)
chr5 (134-251)||(41957424-41957540)
chr5 (154-292)||(17258815-17258952)
chr5 (100-292)||(15074681-15074870)
chr5 (186-291)||(38728434-38728539)
chr5 (204-292)||(11457148-11457236)
chr5 (145-292)||(4619699-4619845)
chr5 (186-292)||(11297128-11297234)
chr5 (152-270)||(30217081-30217197)
chr5 (130-240)||(36542266-36542375)
chr5 (130-292)||(36639499-36639660)
chr5 (100-257)||(37690603-37690760)
chr5 (132-257)||(14295485-14295609)
chr5 (138-242)||(2569677-2569780)
chr5 (136-284)||(12459941-12460088)
chr5 (204-292)||(14980559-14980647)
chr5 (187-270)||(11700332-11700415)
chr5 (132-264)||(19138677-19138810)
chr5 (201-292)||(34117480-34117570)
chr5 (186-257)||(35095753-35095824)
chr5 (130-292)||(40534173-40534337)
chr5 (139-292)||(6109469-6109621)
chr5 (135-228)||(6587103-6587195)
chr5 (189-257)||(7808540-7808609)
chr5 (140-292)||(8177464-8177620)
chr5 (130-175)||(12975324-12975369)
chr5 (197-290)||(29336673-29336766)
chr5 (200-292)||(32849226-32849316)
chr5 (163-292)||(37611147-37611275)
chr5 (163-292)||(37787877-37788005)
chr5 (163-251)||(12242683-12242770)
chr5 (208-256)||(38047847-38047895)
chr5 (221-292)||(5377129-5377200)
chr5 (134-257)||(7674629-7674751)
chr5 (134-292)||(9202680-9202837)
chr5 (141-292)||(35960401-35960550)
chr5 (186-292)||(10125650-10125756)
chr5 (132-214)||(16889714-16889795)
chr5 (138-255)||(26390758-26390875)
chr5 (140-226)||(36638734-36638819)
chr5 (134-251)||(39105445-39105562)
chr5 (187-292)||(499663-499768)
chr5 (134-251)||(1550878-1550994)
chr5 (130-255)||(3951592-3951716)
chr5 (141-214)||(3970690-3970762)
chr5 (202-287)||(13781812-13781897)
chr5 (203-292)||(16016358-16016447)
chr5 (201-250)||(29363055-29363104)
chr5 (187-251)||(2092518-2092582)
chr5 (140-292)||(2568645-2568796)
chr5 (134-292)||(4855679-4855833)
chr5 (224-292)||(12407662-12407730)
chr5 (134-214)||(12425552-12425631)
chr5 (138-246)||(13604827-13604934)
chr5 (186-254)||(35963273-35963341)
chr5 (208-292)||(42646945-42647028)
chr5 (186-257)||(8089968-8090039)
chr5 (186-285)||(12521560-12521659)
chr5 (137-228)||(18543193-18543282)
chr5 (140-215)||(18902783-18902856)
chr5 (201-292)||(38035991-38036082)
chr5 (219-282)||(38885791-38885854)
chr5 (140-175)||(40335919-40335954)
chr5 (188-270)||(985647-985729)
chr5 (152-306)||(25705577-25705730)
chr5 (132-170)||(32059642-32059680)
chr5 (208-254)||(40499696-40499742)
chr5 (154-215)||(4014433-4014493)
chr5 (134-175)||(7319387-7319428)
chr5 (143-292)||(10391331-10391480)
chr5 (192-257)||(13264072-13264137)
chr5 (134-215)||(16944992-16945072)
chr5 (220-257)||(19113086-19113123)
chr5 (135-175)||(26209461-26209502)
chr5 (200-257)||(28982056-28982113)
chr5 (187-292)||(29590562-29590666)
chr5 (132-205)||(35553207-35553279)
chr5 (130-245)||(8651331-8651444)
chr5 (197-257)||(10907421-10907481)
chr5 (186-230)||(12467165-12467209)
chr5 (134-174)||(12595789-12595829)
chr5 (197-257)||(16457580-16457640)
chr5 (197-245)||(18700427-18700475)
chr5 (138-242)||(21768179-21768282)
[»] scaffold0024 (1 HSPs)
scaffold0024 (132-289)||(27555-27711)
[»] scaffold0003 (1 HSPs)
scaffold0003 (163-242)||(306336-306414)
[»] scaffold0110 (1 HSPs)
scaffold0110 (139-292)||(4155-4307)
[»] scaffold0459 (1 HSPs)
scaffold0459 (186-292)||(6578-6684)
[»] scaffold0366 (1 HSPs)
scaffold0366 (186-292)||(6576-6682)
[»] scaffold0020 (1 HSPs)
scaffold0020 (143-292)||(159905-160053)
[»] scaffold0044 (1 HSPs)
scaffold0044 (134-293)||(51883-52039)
[»] scaffold0311 (1 HSPs)
scaffold0311 (187-274)||(10567-10654)
[»] scaffold0254 (1 HSPs)
scaffold0254 (187-274)||(3506-3595)
[»] scaffold0608 (1 HSPs)
scaffold0608 (190-255)||(9606-9671)
[»] scaffold0147 (1 HSPs)
scaffold0147 (197-246)||(12682-12731)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 5e-85; HSPs: 102)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 394 - 557
Target Start/End: Complemental strand, 15866504 - 15866341
Alignment:
394 ttaccttagtcttaggagcaagacctgccataagagcagcagcagcgttaccggcattattttcttcaatgaaactgatagtagagttgataaccaacaa 493  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15866504 ttacctttgtcttaggagcaagacctgccataagagcagcagcagcgttaccggcattattttcttcaatgaaactgatagtagagttgataaccaacaa 15866405  T
494 gcaaataattcccacaaaatcttgccaatctggaggctgtccttctccgttcgcaagagcaatt 557  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15866404 gcaaataattcccacaaaatcttgccaatctggaggctgtccttctccgttcgcaagagcaatt 15866341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 140 - 292
Target Start/End: Complemental strand, 18179323 - 18179172
Alignment:
140 ttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccata 239  Q
    |||||||||||||||||||||||||||||||||||| || ||||  |||| ||||| |||||||||| |||| |||  |||||| |||| | ||| ||||    
18179323 ttttcatataagctataagctgctttcataagctatcctggaga-acttacgaaaataagctgaaaatagctaatggacatgtcttaagatgttttcata 18179225  T
240 agctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    | | || |||||||  |||| |||||||||||| |  ||||||||| ||||||    
18179224 aacacttccaaacaaacttacaagtgcttatgtaactagataagcttaaataa 18179172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 227
Target Start/End: Complemental strand, 15866754 - 15866665
Alignment:
137 ttgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataa 227  Q
    |||||||||||||||||||||||  |||||||||||||| || ||||| |||||| |||||||||||||||| ||||| | ||||||||||    
15866754 ttgttttcatataagctataagccactttcataagctatcctggagag-cttatgtaaacaagctgaaaacaccttatatacatgtcataa 15866665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 132 - 257
Target Start/End: Original strand, 33942129 - 33942255
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagt-- 229  Q
    ||||| ||||||||| ||||||||||| || |||||||||| ||  ||||||| || |||||||  ||||||||||||||||||  ||||||||||||      
33942129 tcaaactgttttcatgtaagctataagttgttttcataagccatcatagagag-ctaatgaaaattagctgaaaacagcttatgaacatgtcataagttg 33942227  T
230 tatttccataagctctcccaaacagtct 257  Q
    | | ||||||||||||| ||||||||||    
33942228 tctctccataagctctctcaaacagtct 33942255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 138 - 292
Target Start/End: Complemental strand, 5759660 - 5759507
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaa-acagcttatgtgcatgtcataagttatttcc 236  Q
    ||||||| |||| ||||||||||| ||||||||||||| || ||| |  || |||||| ||||||||| ||| ||||||  |||||| |||| | |||||    
5759660 tgttttcgtatatgctataagctgttttcataagctattctggagggt-ttgtgaaaataagctgaaacacaacttatggacatgtc-taagctgtttcc 5759563  T
237 ataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||||||||||||||||| | |||| |||||  ||| |||||| |||||||||    
5759562 ataagctctcccaaacagtctcacaagtacttataccaatagataaactcaaataa 5759507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 133 - 215
Target Start/End: Complemental strand, 22681275 - 22681194
Alignment:
133 caaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg 215  Q
    ||||||||||||||||||||||||||||| |||||||| |||| |||||||  |||||| ||| ||||| |||||||||||||    
22681275 caaattgttttcatataagctataagctgttttcataatctatcctagaga-acttatggaaataagctaaaaacagcttatg 22681194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 150 - 292
Target Start/End: Original strand, 32821806 - 32821947
Alignment:
150 agctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctccca 249  Q
    |||||||| ||| ||||||||||||| ||| ||||| ||||  ||| || ||||||||||||||||  ||||||||||||| |||| |||| |||| |||    
32821806 agctataaactgttttcataagctatcctaaagagc-ttatagaaataaactgaaaacagcttatggacatgtcataagttgtttctataaactcttcca 32821904  T
250 aacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||  || |||||| ||    ||||||||||||||||    
32821905 aacagtcttgcaaatgcttacgttggtagataagctcaaataa 32821947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 132 - 292
Target Start/End: Original strand, 33256719 - 33256875
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||| ||||||||||||| |||||||| | |||||||||| || ||  ||| || |||||||| ||||||| ||||| |||||  ||||||||||| |     
33256719 tcaaactgttttcatataaactataagcagttttcataagccatcctgaaga-ccgtatgaaaataagctgagaacagtttatgaacatgtcataagctg 33256817  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||| |||||||||||||||| | ||| | |||| |||||| |||||   ||||||||||||    
33256818 ttttcataagctctcccaaaaattctcagaagtacttatgccaaca---aagctcaaataa 33256875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 132 - 292
Target Start/End: Original strand, 43141850 - 43142010
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||||||||| ||||||||||||||| || ||||||||||||| ||  ||||  ||||| ||| ||  |||||||| |||||| ||||||||||||||     
43141850 tcaaattgtttccatataagctataagatgttttcataagctatcctgaagag-tttatggaaataaaatgaaaacaacttatgggcatgtcataagttg 43141948  T
232 ttt-ccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||| |||||||| ||  ||||| || | | || ||||||||| |  ||||||||||||||||    
43141949 tttcccataagcgctgtcaaactgtttcacaattgcttatgttagtagataagctcaaataa 43142010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 138 - 250
Target Start/End: Original strand, 9556224 - 9556335
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttcca 237  Q
    |||||||||| ||||||||| ||| ||||||||||||| ||||| || |||||||||| ||| ||||| |  ||||||  |||||||| |||| ||| ||    
9556224 tgttttcatacaagctataaactgttttcataagctatcctagaaag-cttatgaaaataagttgaaatctacttatggacatgtcattagttgttttca 9556322  T
238 taagctctcccaa 250  Q
    |||||||||||||    
9556323 taagctctcccaa 9556335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 132 - 292
Target Start/End: Original strand, 10285839 - 10285998
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||| || ||||||||||||||||||  | || |||||||||   |||||| | ||||| ||| ||| |||||||||||||||  ||||||||||||||    
10285839 tcaaactggtttcatataagctataagtcgtttgcataagctaacatagagaac-ttatggaaataagttgaaaacagcttatggacatgtcataagtta 10285937  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||| ||||||||   ||||||  || || |||||||||||  || ||||||||| ||||||    
10285938 ttttcataagctaaaccaaaccctcatacaagtgcttatgcaaatagataagcttaaataa 10285998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 186 - 306
Target Start/End: Original strand, 18884899 - 18885019
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    |||||| ||| || |||||||||||| |||   |||||||||| | |||| |||||||||||||||||| |||| |||| |||||||||| ||||| |||    
18884899 cttatggaaataatctgaaaacagctaatggaaatgtcataagctgtttctataagctctcccaaacagccttacaagttcttatgtcaatagatacgct 18884998  T
286 caaataacttgatcctaacag 306  Q
    | ||||| | ||||| |||||    
18884999 cgaataagtcgatccaaacag 18885019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 132 - 292
Target Start/End: Original strand, 40158697 - 40158856
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||| ||||||| ||||||| ||||| || ||||||||| ||| || |||||| ||||| ||  |||||||||||| |||||   ||||||||||| |     
40158697 tcaaactgttttcgtataagcaataagttgttttcataagttattctggagagc-ttatgtaattaagctgaaaacaacttataaacatgtcataagctg 40158795  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||| |||||| || ||||| |||||| | |||| |||||||||  ||||| ||||||||||    
40158796 ttttcataagttcccccaatcagtctcacaagttcttatgtcagtagatatgctcaaataa 40158856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 134 - 292
Target Start/End: Original strand, 8017415 - 8017572
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatt 233  Q
    ||||| |||||||||||||| ||| ||| |||||||||||||  | |||| | ||||||||| | || |||||||  |||||  ||| ||||||| | ||    
8017415 aaattattttcatataagctgtaaactgttttcataagctatcttggagaac-ttatgaaaatacgcagaaaacaaattatgaacatatcataagctgtt 8017513  T
234 tccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    | |||||| ||||||||| | ||  | ||||||||||||||| |||||| |||||||||    
8017514 ttcataagttctcccaaataatcgcacaagtgcttatgtcaatagataacctcaaataa 8017572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 140 - 214
Target Start/End: Complemental strand, 13736376 - 13736303
Alignment:
140 ttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttat 214  Q
    |||||| || |||||||||||| |||||||||||||||||||||| |||||||||| ||  ||||||||||||||    
13736376 ttttcacatcagctataagctgttttcataagctatactagagag-cttatgaaaataacttgaaaacagcttat 13736303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 187 - 292
Target Start/End: Original strand, 16503385 - 16503491
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtg-catgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    ||||||||| ||||||||| | ||||||||| ||||||||||| ||||||  |||||||||||||||||| | | |||| |||||| ||  |||||| ||    
16503385 ttatgaaaataagctgaaaccggcttatgtgacatgtcataagctatttctctaagctctcccaaacagtgtcacaagtacttatgccactagataatct 16503484  T
286 caaataa 292  Q
    |||||||    
16503485 caaataa 16503491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 130 - 292
Target Start/End: Original strand, 28933801 - 28933961
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagt 229  Q
    ||||||||| ||||||| |||| |||||  || ||||||||||||| |||||||| || ||  ||| ||| |||||||||| ||||  |||| |||||||    
28933801 aatcaaattattttcatttaagttataaattgttttcataagctatcctagagag-ctgatagaaataagttgaaaacagc-tatgaacatgccataagt 28933898  T
230 tatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    | ||| |||||||||| |||||||| |||| || || ||||| ||  |||||||||| |||||    
28933899 tgttttcataagctcttccaaacagacttataaatgtttatggcactagataagctctaataa 28933961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 153 - 265
Target Start/End: Original strand, 11488277 - 11488386
Alignment:
153 tataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaac 252  Q
    ||||||||||||||||||||||| || |||||  ||||| ||| |||||||||||| ||||||  ||  ||||||||| ||| |||||||||||  ||||    
11488277 tataagctgctttcataagctatcctggagag-attatgcaaataagctgaaaacaacttatgacca--tcataagttgttttcataagctctcataaac 11488373  T
253 agtcttaaaagtg 265  Q
    | |||||||||||    
11488374 aatcttaaaagtg 11488386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 132 - 292
Target Start/End: Original strand, 11513877 - 11514034
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||||||||||||||||||||||||| || |||||||||||||  | ||||  ||| || ||| |||||||||| |||||||  ||||| |||  | |     
11513877 tcaaattgttttcatataagctataagttgttttcataagctatcatggaga-acttttggaaataagctgaaaatagcttataggcatgccat--gctg 11513973  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||| |||||||||||  ||||||||| | |||||||||||  |  |||||| |||||||||    
11513974 ttttcataagctctctaaaacagtctcacaagtgcttatgctagtagataatctcaaataa 11514034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 186 - 275
Target Start/End: Complemental strand, 44606148 - 44606059
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaa 275  Q
    ||||||||||  ||||||||||| ||||||  ||||||||||||| ||| |||||| ||| |||||||||| || |||| ||||||||||    
44606148 cttatgaaaatcagctgaaaacaacttatggacatgtcataagttgttttcataagttcttccaaacagtcgtacaagtacttatgtcaa 44606059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 9395111 - 9395190
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttat 214  Q
    ||||||||||||||||| |||||||||| |||||| || ||| ||  |||| |||||||||| ||||||||||||||||||    
9395111 aaattgttttcatataatctataagctgttttcattagttattctgtagag-cttatgaaaataagctgaaaacagcttat 9395190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 186 - 254
Target Start/End: Original strand, 15120215 - 15120283
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacag 254  Q
    ||||| |||| ||||| ||||||||| |||  ||||||||||||| |||||||||||||||||||||||    
15120215 cttatcaaaataagcttaaaacagctaatgaacatgtcataagttgtttccataagctctcccaaacag 15120283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 132 - 292
Target Start/End: Complemental strand, 17221631 - 17221472
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    |||||||||| ||||||||||||| |  || ||||||||||||| | ||||| | ||| | ||| ||||| |||| || |||||   |||||||||| ||    
17221631 tcaaattgttctcatataagctattaagtgttttcataagctatccgagagatc-ttacggaaataagctaaaaaaagtttatggatatgtcataagata 17221533  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||||| || |||||||| | ||||||| ||| ||  ||||||  ||||||||    
17221532 tttccataagctcttccgaacagtctcagaagtgctaatgacagtagataatttcaaataa 17221472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 134 - 241
Target Start/End: Original strand, 18066109 - 18066216
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgc-atgtcataagttat 232  Q
    |||||||||||||||||||||||||||| |||||||||||||  | ||||  |||| ||||| ||| |||||| |||||||| || |||||||||| | |    
18066109 aaattgttttcatataagctataagctgttttcataagctatcttggaga-acttaagaaaataaggtgaaaatagcttatgagcaatgtcataagctgt 18066207  T
233 ttccataag 241  Q
    || ||||||    
18066208 tttcataag 18066216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 220 - 292
Target Start/End: Original strand, 22878164 - 22878236
Alignment:
220 tgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||| || |||||||||| ||||||||||||||| | ||||||||||||||   |||||||||||||||    
22878164 tgtcataatttgtttccataaggtctcccaaacagtctcacaagtgcttatgtcagtggataagctcaaataa 22878236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 292
Target Start/End: Original strand, 3973609 - 3973680
Alignment:
221 gtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||| |||||||| |||||| |||||||||||| |||||||||| |||   |||||||||||||||    
3973609 gtcataagttgtttccatatgctctctcaaacagtcttataagtgcttatatcagtggataagctcaaataa 3973680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 138 - 257
Target Start/End: Original strand, 5452312 - 5452429
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttcca 237  Q
    |||||| |||||| ||||||| | |||||| |||||||  |||||||| | || || | |||||||| ||||||||||| ||||||||||||| |||| |    
5452312 tgttttaatataaactataagtt-ctttcacaagctatcgtagagagc-tgatcaagataagctgaatacagcttatgtacatgtcataagttttttcta 5452409  T
238 taagctctcccaaacagtct 257  Q
    ||| |||| |||||||||||    
5452410 taatctcttccaaacagtct 5452429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 292
Target Start/End: Original strand, 33192206 - 33192339
Alignment:
157 agctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtc 256  Q
    ||||| ||||||||||||| || |||||| |||| || | |||||||||||||||||||   |||||||||  | ||| |||||| ||| | ||||||||    
33192206 agctggtttcataagctatcctggagagc-ttataaatataagctgaaaacagcttatggatatgtcataaactgttttcataagttcttc-aaacagtc 33192303  T
257 ttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    | |  |||| |||||||| |||||||||||||||||    
33192304 tcatgagtgtttatgtcagcagataagctcaaataa 33192339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 177 - 292
Target Start/End: Complemental strand, 43529904 - 43529790
Alignment:
177 ctagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaac 276  Q
    ||||||||| ||||||||| || ||||||| ||||||||  |||| |||||| | ||| |||||  ||||||||||||| | | ||||||||||  |||     
43529904 ctagagagc-ttatgaaaataaactgaaaatagcttatgaacatggcataagctgttttcataaattctcccaaacagtgtcagaagtgcttataccaat 43529806  T
277 agataagctcaaataa 292  Q
    ||||||||||||||||    
43529805 agataagctcaaataa 43529790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 359 - 397
Target Start/End: Complemental strand, 15866665 - 15866627
Alignment:
359 aacattttagtgttctactaattaaagtgatcattttac 397  Q
    |||||||||||||||||||||||||||||||||||||||    
15866665 aacattttagtgttctactaattaaagtgatcattttac 15866627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 186 - 292
Target Start/End: Original strand, 43985241 - 43985347
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    |||||| ||||||| |||||| ||||||||  ||||||||||||| ||||  ||| ||||| |||||||| ||| ||||| ||||||||  |||||| ||    
43985241 cttatggaaacaagttgaaaaaagcttatggacatgtcataagttgtttcagtaatctctctcaaacagttttacaagtgtttatgtcagtagataaact 43985340  T
286 caaataa 292  Q
     ||||||    
43985341 taaataa 43985347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 203 - 256
Target Start/End: Original strand, 4550796 - 4550849
Alignment:
203 aaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtc 256  Q
    |||| ||||||||  ||||||||||||| |||||||||||||||||||||||||    
4550796 aaaatagcttatgaacatgtcataagttgtttccataagctctcccaaacagtc 4550849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 132 - 257
Target Start/End: Complemental strand, 6993815 - 6993691
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||||| | ||||||||||||||| | || ||||||||||||| || ||||| |||||||||| ||||| ||||   ||||||  |||| |||||| ||    
6993815 tcaaattatattcatataagctataggttgttttcataagctatgcttgagag-cttatgaaaataagctaaaaatgacttatggacatgccataagcta 6993717  T
232 tttccataagctctcccaaacagtct 257  Q
    ||| |||||| |||  ||||||||||    
6993716 tttacataagttctatcaaacagtct 6993691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 136 - 292
Target Start/End: Original strand, 15377748 - 15377903
Alignment:
136 attgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagc-tgaaaacagcttatgtgcatgtcataagttattt 234  Q
    |||||||||||||||| ||||||||| ||||||||||||| || |||   |||||||||| || | | |||| ||||||||  | ||||||||||| |||    
15377748 attgttttcatataagttataagctgttttcataagctattct-gaggagcttatgaaaataaacttaaaaatagcttatggacgtgtcataagttgttt 15377846  T
235 ccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||| || | | |||||||| |||| || ||||||||| |  | ||||||||||||||    
15377847 ccat-agattttccaaacagccttacaattgcttatgttagtacataagctcaaataa 15377903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 134 - 175
Target Start/End: Original strand, 25800810 - 25800851
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctat 175  Q
    |||||||||||||||||||||||||||| |||||||||||||    
25800810 aaattgttttcatataagctataagctgttttcataagctat 25800851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 187 - 292
Target Start/End: Complemental strand, 27237930 - 27237825
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctc 286  Q
    ||||| ||| ||||| |||||||||||||| ||||||||||| | |||| ||||| ||| ||||||||| | |  |||| |||||||| ||||||||  |    
27237930 ttatggaaataagctaaaaacagcttatgtacatgtcataagctgtttctataagttctaccaaacagtttcactagtgtttatgtcagcagataagaac 27237831  T
287 aaataa 292  Q
    ||||||    
27237830 aaataa 27237825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 145 - 257
Target Start/End: Complemental strand, 1742110 - 1741999
Alignment:
145 atataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctc 244  Q
    ||||||| ||||||||| |||||||| ||||  |  ||||  ||||| ||| ||| |||| | ||||||||  ||||||||||||| |||||||||||||    
1742110 atataagatataagctgttttcataatctatcatgaagagt-ttatggaaataagttgaagatagcttatgcacatgtcataagttgtttccataagctc 1742012  T
245 tcccaaacagtct 257  Q
    ||||||| |||||    
1742011 tcccaaatagtct 1741999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 150 - 230
Target Start/End: Complemental strand, 1939404 - 1939326
Alignment:
150 agctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtt 230  Q
    |||||||| ||| |||||||||||||||| |||||| ||||| ||| ||| |||||||||||||||  |||||||||||||    
1939404 agctataa-ctgttttcataagctatactggagagc-ttatggaaataagttgaaaacagcttatggacatgtcataagtt 1939326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 139 - 243
Target Start/End: Original strand, 12215793 - 12215896
Alignment:
139 gttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccat 238  Q
    |||| |||||| ||||||||||| ||| |||||| || || |||||| |||||  || | | |||||||||||||||  ||||||||||| |||||||||    
12215793 gtttccatatatgctataagctgtttttataagccatccttgagagc-ttatgggaatatggtgaaaacagcttatggacatgtcataagctatttccat 12215891  T
239 aagct 243  Q
    |||||    
12215892 aagct 12215896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 140 - 291
Target Start/End: Complemental strand, 30552727 - 30552576
Alignment:
140 ttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaac-agcttatgtgcatgtcataagttatttccat 238  Q
    ||||||||| ||||||||  |  |||||||| |||| ||||||||| ||||| ||| ||||| ||||| | |||||   ||||||||||||| |||| ||    
30552727 ttttcatatcagctataaattattttcataaactatcctagagagc-ttatggaaataagctaaaaaccaacttattgacatgtcataagttgtttcgat 30552629  T
239 aagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaata 291  Q
    || || || |||||||| | ||||||||||||  ||  |||||||||||||||    
30552628 aacctatctcaaacagtttcaaaagtgcttataccagtagataagctcaaata 30552576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 197 - 292
Target Start/End: Original strand, 787375 - 787470
Alignment:
197 aagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||||||||||  ||||||||||| | ||| |||||| |||| |||||||| | | ||||||||||| ||  ||||| |||| |||||    
787375 aagctgaaaacagcttatggacatgtcataagctgttttcataagttctcacaaacagtgtcacaagtgcttatgccagtagatatgctcgaataa 787470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 192 - 271
Target Start/End: Complemental strand, 5902581 - 5902502
Alignment:
192 aaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatg 271  Q
    |||||||||||||||||| |||||  ||||||||||| | ||| |||||| ||| ||||||||||| | ||||| |||||    
5902581 aaaacaagctgaaaacagtttatgaacatgtcataagctgttttcataagttcttccaaacagtctcacaagtgtttatg 5902502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 49 - 120
Target Start/End: Original strand, 10150651 - 10150722
Alignment:
49 tgtttggataaacatcgtaatcaagcacttataatataaatgtttgcgtacaagttatttctataataaaag 120  Q
    ||||| |||||||| | |||| |||||||||| |||||| |||||  ||| |||||||||||||||||||||    
10150651 tgtttagataaacaacttaattaagcacttattatataagtgtttatgtataagttatttctataataaaag 10150722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 186 - 257
Target Start/End: Original strand, 11063520 - 11063591
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    |||||||||| ||||| |||||| ||||||  ||||||||||  | |||||||||||||| |||||||||||    
11063520 cttatgaaaataagctaaaaacaacttatggacatgtcataatatgtttccataagctcttccaaacagtct 11063591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 186 - 285
Target Start/End: Complemental strand, 16551878 - 16551779
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    |||||| ||| |||||||| ||| |||||||  |||||||||| | |||||||||||||| | ||||| |||   ||||| ||||||||| |||||||||    
16551878 cttatggaaataagctgaatacaacttatgtatatgtcataagatctttccataagctcttctaaacaatctcgcaagtgtttatgtcaatagataagct 16551779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 187 - 270
Target Start/End: Complemental strand, 29429794 - 29429711
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttat 270  Q
    ||||||||| | |||||||||||||  ||   ||||||| |||| |||| ||||||||||||||||||||| | ||||||||||    
29429794 ttatgaaaatatgctgaaaacagctagtgaatatgtcattagttgtttctataagctctcccaaacagtctcacaagtgcttat 29429711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 186 - 285
Target Start/End: Complemental strand, 41809283 - 41809184
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    |||||| ||| ||||| |||||| ||||||  ||||||||||||| |||||| |||||||  ||| |||||| | ||||| ||||| ||||| |||||||    
41809283 cttatggaaataagctaaaaacaacttatgaacatgtcataagttgtttccacaagctcttacaatcagtctcacaagtgtttatgccaacaaataagct 41809184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 167 - 241
Target Start/End: Original strand, 1647250 - 1647323
Alignment:
167 ataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataag 241  Q
    |||||||||  |||||||| ||||| ||| ||||||||||||||||||| |||||||||||| | ||| ||||||    
1647250 ataagctattatagagagc-ttatggaaataagctgaaaacagcttatgagcatgtcataagctgttttcataag 1647323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 153 - 275
Target Start/End: Original strand, 10567057 - 10567178
Alignment:
153 tataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaac 252  Q
    ||||| ||| || ||||| |||| || |||||| || ||||||  ||||||||||| ||||||  ||||||||||| | |||||| || |||||||||||    
10567057 tataaactgtttccataaactattctggagagc-ttgtgaaaattagctgaaaacaacttatgatcatgtcataagctgtttccacaatctctcccaaac 10567155  T
253 agtcttaaaagtgcttatgtcaa 275  Q
    ||||| |  ||| ||||||||||    
10567156 agtctcacgagtacttatgtcaa 10567178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 163 - 257
Target Start/End: Original strand, 19629373 - 19629464
Alignment:
163 tttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    |||||||||||||||| |||||  ||||||||| ||| ||||| |||||||| || |||| ||||||| |||||||||| ||||||||| |||||    
19629373 tttcataagctatactggagag-tttatgaaaataagttgaaatcagcttat-tg-atgttataagttgtttccataagttctcccaaatagtct 19629464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 134 - 255
Target Start/End: Original strand, 26626854 - 26626975
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgc-atgtcataagttat 232  Q
    ||||||||||| ||||||||| |||||| |||||||||||||  |  |||  |||||||||| || |||||||||| |||||  | |||||||||| |||    
26626854 aaattgttttcgtataagctagaagctgttttcataagctatcttgcaga-acttatgaaaataacctgaaaacagattatgaacaatgtcataagctat 26626952  T
233 ttccataagctctcccaaacagt 255  Q
    || | |||| ||||||| |||||    
26626953 tttcgtaagttctcccatacagt 26626975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 132 - 233
Target Start/End: Original strand, 29633051 - 29633152
Alignment:
132 tcaaattgttttcata-taagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtt 230  Q
    |||||||||||||||| | | |||||||||  ||||||||||||| ||| | ||| |||| |||| | |||||||||||||||||   ||||||||||||    
29633051 tcaaattgttttcataattaactataagctcttttcataagctatcctaaatagc-ttatcaaaatatgctgaaaacagcttatggagatgtcataagtt 29633149  T
231 att 233  Q
    |||    
29633150 att 29633152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 140 - 214
Target Start/End: Original strand, 39983329 - 39983402
Alignment:
140 ttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttat 214  Q
    ||||||||||||||||||| || ||||||||||||| || ||||| || ||||||| || ||||||| |||||||    
39983329 ttttcatataagctataagttgttttcataagctatcctggagag-ctaatgaaaataaactgaaaatagcttat 39983402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 40672862 - 40672781
Alignment:
171 gctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaaca 253  Q
    ||||||||||||||| ||||||||| ||  ||||||||| |||||  |||| ||| |||| |||||||||||||| |||||||    
40672862 gctatactagagagc-ttatgaaaataaagtgaaaacagtttatgatcatgccatgagttgtttccataagctcttccaaaca 40672781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 187 - 292
Target Start/End: Original strand, 9996771 - 9996876
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctc 286  Q
    ||||||||| ||| ||| ||||  ||||| | |||||||||||| |||| |||||||||||||| |||||| | |||| ||||||  |   |||||||||    
9996771 ttatgaaaataagttgagaacaatttatgggtatgtcataagttgtttctataagctctcccaagcagtctcacaagtacttatgctagttgataagctc 9996870  T
287 aaataa 292  Q
    ||||||    
9996871 aaataa 9996876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 190 - 291
Target Start/End: Original strand, 13866914 - 13867015
Alignment:
190 tgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaa 289  Q
    |||||| ||||||||| |||| |||  |||||||||| ||| ||| | |||| |||| |||||||||| | ||||| ||||| ||  |||||||||||||    
13866914 tgaaaataagctgaaatcagcatataggcatgtcataggttgttttcttaagttctctcaaacagtctcacaagtgtttatggcagtagataagctcaaa 13867013  T
290 ta 291  Q
    ||    
13867014 ta 13867015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 138 - 259
Target Start/End: Complemental strand, 18962123 - 18962002
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttcca 237  Q
    |||||||||||||||||||| ||  |||||||||||||  | ||||| ||   ||||  ||||||||||||||  |||  ||||||||| | | ||| ||    
18962123 tgttttcatataagctataaactattttcataagctatcatggagagactatggaaataaagctgaaaacagcacatgaacatgtcatatgctgttttca 18962024  T
238 taagctctcccaaacagtctta 259  Q
    ||||||||||| ||||| ||||    
18962023 taagctctcccgaacagcctta 18962002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 140 - 252
Target Start/End: Complemental strand, 938593 - 938482
Alignment:
140 ttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccata 239  Q
    |||||||||||||||||||| |  ||||||||||||  ||||||| ||| |||||| ||| | ||||  |||||||    |||||||||||  |||||||    
938593 ttttcatataagctataagcggtattcataagctatcttagagag-cttctgaaaataagtttaaaatggcttatggatttgtcataagtttcttccata 938495  T
240 agctctcccaaac 252  Q
    ||||||| |||||    
938494 agctctctcaaac 938482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 197 - 257
Target Start/End: Complemental strand, 14316172 - 14316112
Alignment:
197 aagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    ||||||||||||||||||    |||||||||||| |||||||||||||||| ||| |||||    
14316172 aagctgaaaacagcttatacatatgtcataagttgtttccataagctctccaaaatagtct 14316112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 240 - 292
Target Start/End: Complemental strand, 15200317 - 15200265
Alignment:
240 agctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||| |||||||||| | |||| |||||| ||||||||||||||||||||    
15200317 agctctcacaaacagtctcacaagtacttatgccaacagataagctcaaataa 15200265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 292
Target Start/End: Original strand, 25609862 - 25609934
Alignment:
220 tgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||||||| |||||||||||| | |||| |||||| | |||| ||||||| |  ||||||||||||||||    
25609862 tgtcataagttgtttccataagctattccaagcagtctcacaagttcttatgttagtagataagctcaaataa 25609934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 208 - 292
Target Start/End: Complemental strand, 28803546 - 28803462
Alignment:
208 agcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||||  ||||||||||||| |||||||| | |||| |||||||||| | | ||||||||| |   ||||||||||||||||    
28803546 agcttatggacatgtcataagttgtttccatatgttctctcaaacagtctcacatgtgcttatgccggtagataagctcaaataa 28803462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 197 - 257
Target Start/End: Complemental strand, 32098357 - 32098297
Alignment:
197 aagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    |||||||||| ||||||   ||||| |||||| |||||||||||| |||||||||||||||    
32098357 aagctgaaaatagcttacaggcatgccataagctatttccataagatctcccaaacagtct 32098297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 163 - 243
Target Start/End: Complemental strand, 34652096 - 34652017
Alignment:
163 tttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagct 243  Q
    |||||||||||||  | |||||| ||||| ||| ||| |||||||||||||||  ||||||||||||| |||| |||||||    
34652096 tttcataagctatcttggagagc-ttatggaaataagttgaaaacagcttatggacatgtcataagttgtttctataagct 34652017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 188 - 272
Target Start/End: Complemental strand, 43456743 - 43456659
Alignment:
188 tatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgt 272  Q
    |||| ||| ||||||||||||| |||||  |||||||| |||| ||| || |||||||  |||||||||||| ||||| ||||||    
43456743 tatggaaataagctgaaaacagtttatggacatgtcatgagttgttttcacaagctctttcaaacagtcttacaagtgtttatgt 43456659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 218 - 274
Target Start/End: Original strand, 43808622 - 43808678
Alignment:
218 catgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtca 274  Q
    ||||||||||||||||| ||||||||||| |||| ||||||| ||||  ||||||||    
43808622 catgtcataagttattttcataagctctctcaaatagtcttacaagtatttatgtca 43808678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 129 - 228
Target Start/End: Complemental strand, 656871 - 656773
Alignment:
129 taatcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataag 228  Q
    |||||||||||||||| |||||||| |||| || |||||||||||||  |  |||| |||||||||| ||| |||||||  |||||  || |||||||||    
656871 taatcaaattgttttcgtataagctgtaagttgatttcataagctatcttgcagag-cttatgaaaataagatgaaaactacttataggcgtgtcataag 656773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 292
Target Start/End: Original strand, 1625881 - 1626038
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgca-tgtcataagttat 232  Q
    ||||||||||| |||||| |||||| || |||||||||||||  | ||||  |||| |||||  ||||||||||| ||||||  || ||||||||| ||     
1625881 aaattgttttcgtataagttataagttgttttcataagctatcttggaga-acttacgaaaatcagctgaaaacatcttatgaacattgtcataagctac 1625979  T
233 ttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    || |||||| |||| |||| ||||||| ||   |||||||||   |||||||||||||||    
1625980 tttcataagttctctcaaatagtcttacaa-aacttatgtcaggggataagctcaaataa 1626038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 186 - 253
Target Start/End: Original strand, 1830077 - 1830144
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaaca 253  Q
    |||||| ||| |||||||||||  | ||||  ||||||||||| | ||||||||||||||||||||||    
1830077 cttatggaaataagctgaaaactccctatggacatgtcataagatgtttccataagctctcccaaaca 1830144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 187 - 274
Target Start/End: Complemental strand, 3067416 - 3067329
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtca 274  Q
    ||||||||| ||||| ||||| |||||| | ||| | ||||| | ||| ||||||||||||| ||| |||| | ||||||||||||||    
3067416 ttatgaaaataagctaaaaacggcttatatacatattataagctgttttcataagctctcccgaacggtctcagaagtgcttatgtca 3067329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 152 - 215
Target Start/End: Original strand, 9174814 - 9174876
Alignment:
152 ctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg 215  Q
    |||||||||| |||||||||||||  || |||| |||||||||| |||||||||| ||||||||    
9174814 ctataagctgttttcataagctatcttacagag-cttatgaaaataagctgaaaatagcttatg 9174876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 202 - 269
Target Start/End: Complemental strand, 9878704 - 9878637
Alignment:
202 gaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgctta 269  Q
    ||||||| ||||||  ||||||||||||| |||||||||||||| ||  ||||||| | |||||||||    
9878704 gaaaacaacttatggacatgtcataagttgtttccataagctcttccctacagtctcagaagtgctta 9878637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 152 - 215
Target Start/End: Complemental strand, 10884592 - 10884530
Alignment:
152 ctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg 215  Q
    |||||||||| ||||||||||||| |||||||| |||||||||| ||| ||| ||| |||||||    
10884592 ctataagctgttttcataagctatcctagagag-cttatgaaaataagttgagaactgcttatg 10884530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 186 - 289
Target Start/End: Original strand, 13234538 - 13234641
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    |||||||| | ||| |||||||| ||||||  ||||||||||  | |||   ||||| ||| |||||||||||| ||||||||||| |||  ||||||||    
13234538 cttatgaagataagttgaaaacaacttatggacatgtcataatgtgtttttgtaagcactctcaaacagtcttacaagtgcttatgccaattgataagct 13234637  T
286 caaa 289  Q
    ||||    
13234638 caaa 13234641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 197 - 292
Target Start/End: Original strand, 29430801 - 29430896
Alignment:
197 aagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||| ||| ||||| |||  ||||||||||| ||||| |||||| ||| ||||| ||||  | ||||| ||||||||  ||||||||||||||||    
29430801 aagcttaaagcagctaatggacatgtcataagctattttcataagttcttccaaatagtcccacaagtgtttatgtcagtagataagctcaaataa 29430896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 233 - 288
Target Start/End: Original strand, 34927042 - 34927097
Alignment:
233 ttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaa 288  Q
    ||||||||| ||| ||||||||||||| ||||||||||||||  | ||||||||||    
34927042 ttccataagttcttccaaacagtcttataagtgcttatgtcagtaaataagctcaa 34927097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 146 - 273
Target Start/End: Original strand, 35485910 - 35486036
Alignment:
146 tataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctct 245  Q
    ||||||||||||| || ||| ||||||||| ||  ||||||| ||| |||  ||||||||||||||||||  ||| |||||||||  ||   |||| |||    
35485910 tataagctataagttgtttttataagctatcctgaagagcct-atggaaatgagctgaaaacagcttatgaacatatcataagttgctttagtaagttct 35486008  T
246 cccaaacagtcttaaaagtgcttatgtc 273  Q
    | |||||||||| | |||| ||||||||    
35486009 ctcaaacagtctcacaagttcttatgtc 35486036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 137 - 172
Target Start/End: Original strand, 42592323 - 42592358
Alignment:
137 ttgttttcatataagctataagctgctttcataagc 172  Q
    ||||||||||||||||||||||||| ||||||||||    
42592323 ttgttttcatataagctataagctgttttcataagc 42592358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 197 - 268
Target Start/End: Original strand, 43811153 - 43811224
Alignment:
197 aagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgctt 268  Q
    |||||||||||||||||||  |||| |||||||| |||||||||| | || |||||||| | | ||||||||    
43811153 aagctgaaaacagcttatgaccatgccataagttgtttccataaggtttctcaaacagtatcacaagtgctt 43811224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 134 - 228
Target Start/End: Original strand, 680484 - 680577
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataag 228  Q
    ||||||||||| |||||||||||||||  ||||||||||||| || ||    ||| |||||| ||||||||||||| ||||   |||||||||||    
680484 aaattgttttcgtataagctataagctattttcataagctat-cttgaagaacttgtgaaaataagctgaaaacagtttataaacatgtcataag 680577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 138 - 256
Target Start/End: Original strand, 5133757 - 5133874
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttcca 237  Q
    |||||| ||||||| ||||||||| ||||| ||| |||   ||||||| ||||| ||| |||||||||  ||||||||  ||||||||||||| |||  |    
5133757 tgtttttatataagatataagctgttttcaaaagttatctaagagagc-ttatggaaataagctgaaagtagcttatgaccatgtcataagttgttttta 5133855  T
238 taagctctcccaaacagtc 256  Q
    ||| | || ||||||||||    
5133856 taatcccttccaaacagtc 5133874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 134 - 251
Target Start/End: Complemental strand, 10563647 - 10563533
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatt 233  Q
    ||||||||||  | |||| |||||| || ||||||||||||| ||  |||| |||| ||||| |||||||||| ||||||||  ||||||||| | | ||    
10563647 aaattgtttttttgtaagttataagttgttttcataagctatgctgaagag-cttaagaaaataagctgaaaatagcttatggacatgtcataggctgtt 10563549  T
234 tccataagctctcccaaa 251  Q
    |||  |||||||||||||    
10563548 tcc--aagctctcccaaa 10563533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 164 - 250
Target Start/End: Original strand, 17380578 - 17380664
Alignment:
164 ttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaa 250  Q
    |||||||||||  ||||| ||| |  |||||| ||||||||||||||||||   ||||||| ||||| ||| |||||| ||||||||    
17380578 ttcataagctaccctagaaagcttattgaaaaaaagctgaaaacagcttattgacatgtcacaagttgtttacataagatctcccaa 17380664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 187 - 292
Target Start/End: Complemental strand, 17775503 - 17775398
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagt-tatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    ||||||||| ||||||||||||||||| |   |||||||||   | ||| ||||| | ||| |||||||||||||||| ||||||||||  ||||| |||    
17775503 ttatgaaaataagctgaaaacagcttaagaa-atgtcataaaactgttttcataaaccctctcaaacagtcttaaaagagcttatgtcagtagatatgct 17775405  T
286 caaataa 292  Q
    |||||||    
17775404 caaataa 17775398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 163 - 257
Target Start/End: Original strand, 19826274 - 19826365
Alignment:
163 tttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    |||||||||||||||| |||||  ||||||||| ||| ||||| ||| |||| || |||| ||||||| |||||||||| ||||||||| |||||    
19826274 tttcataagctatactggagag-tttatgaaaataagttgaaatcagtttat-tg-atgttataagttgtttccataagttctcccaaatagtct 19826365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 134 - 228
Target Start/End: Complemental strand, 29316864 - 29316771
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataag 228  Q
    |||||||||||| |||| |||||||||| |||||| ||||||  | ||||  |||||| ||| |||||||||| | ||||||  |||||||||||    
29316864 aaattgttttcacataatctataagctgttttcatcagctatcttggaga-acttatggaaataagctgaaaagaacttatgaacatgtcataag 29316771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 271
Target Start/End: Original strand, 1318300 - 1318353
Alignment:
218 catgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatg 271  Q
    ||||||||||| | ||| ||||||||||| |||||||||| | |||||||||||    
1318300 catgtcataagatgttttcataagctctcacaaacagtctcacaagtgcttatg 1318353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 190 - 255
Target Start/End: Complemental strand, 1494480 - 1494415
Alignment:
190 tgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagt 255  Q
    |||||| ||||| ||||||| |||||  ||||||||||| | ||| ||||||||||| ||||||||    
1494480 tgaaaataagctaaaaacagtttatggacatgtcataagctgttttcataagctctctcaaacagt 1494415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 292
Target Start/End: Complemental strand, 7103574 - 7103405
Alignment:
132 tcaaattgttttcatataagctataagctg-ctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatg------tca 224  Q
    ||||| |||||| |||||||||||||||||  |||||||||||||  |||||||  || |||||| ||||| |||||| ||||||   |||      |||    
7103574 tcaaactgttttaatataagctataagctgtttttcataagctatcttagagag-tttgtgaaaataagctaaaaacaacttatggatatgtcatactca 7103476  T
225 taagttatttccata---agctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||| ||| ||||   |||||||||||||| ||| | | ||||| ||||||| |||||| |||||||||    
7103475 taagttgtttacatacatagctctcccaaacaatctcacatgtgctcatgtcaatagataaactcaaataa 7103405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 140 - 225
Target Start/End: Complemental strand, 10198563 - 10198479
Alignment:
140 ttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcat 225  Q
    |||||||||||| |||| |||| ||| |||| |||| ||||||||  ||||| ||| ||||||| |||||||||||  ||||||||    
10198563 ttttcatataagatataggctgtttttataatctatcctagagag-attatggaaataagctgacaacagcttatgaacatgtcat 10198479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 186 - 259
Target Start/End: Complemental strand, 28677697 - 28677624
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtctta 259  Q
    |||||| ||| |||| ||||||| ||||||   |||||||||| | ||| |||||| |||||||||||||||||    
28677697 cttatggaaataagccgaaaacaacttatgaaaatgtcataagctgttttcataagttctcccaaacagtctta 28677624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 43635139 - 43635074
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaa 251  Q
    |||||||||| ||||| |||||||||||    ||||||||||||| |||| ||| |||||||||||    
43635139 cttatgaaaataagcttaaaacagcttacagacatgtcataagttttttctatatgctctcccaaa 43635074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 1056167 - 1056123
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtt 230  Q
    ||||||||||||||||||||||| || |||  |||||||||||||    
1056167 cttatgaaaacaagctgaaaacaactaatgaacatgtcataagtt 1056123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 8820330 - 8820246
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttat 270  Q
    |||||| ||| |||||||||||||||| ||  ||||||| ||| | |||||||||| ||||  || ||||||  |||||||||||    
8820330 cttatggaaataagctgaaaacagcttgtgaacatgtcagaagctgtttccataaggtctcttaagcagtctcgaaagtgcttat 8820246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 163 - 251
Target Start/End: Complemental strand, 9530788 - 9530702
Alignment:
163 tttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaa 251  Q
    ||||||||||||| || |||||| ||||||||  ||||| |||| | ||||||  ||||||||| | |||||||||||||||| |||||    
9530788 tttcataagctatcctggagagc-ttatgaaagtaagctaaaaataacttatggacatgtcata-gctatttccataagctcttccaaa 9530702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 186 - 246
Target Start/End: Original strand, 10285387 - 10285447
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctc 246  Q
    |||| ||||| |||||||||||||||||||  |||||||||| || | ||||| |||||||    
10285387 cttaagaaaataagctgaaaacagcttatggacatgtcataacttgtctccattagctctc 10285447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 195 - 255
Target Start/End: Complemental strand, 11344799 - 11344739
Alignment:
195 acaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagt 255  Q
    ||||| ||||||||| |||||  ||||||||||||| |||||||||| |||  ||||||||    
11344799 acaagttgaaaacagtttatggacatgtcataagttgtttccataaggtctgtcaaacagt 11344739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 220 - 292
Target Start/End: Complemental strand, 14277897 - 14277825
Alignment:
220 tgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||||||| ||||||| |||||| ||||||| ||| | |||| ||||||||   |||||| |||||||||    
14277897 tgtcataagttgtttccatgagctcttccaaacactctcacaagtacttatgtccgtagataaactcaaataa 14277825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 190 - 257
Target Start/End: Original strand, 16451154 - 16451222
Alignment:
190 tgaaaacaagctgaaaacagcttatgtgca-tgtcataagttatttccataagctctcccaaacagtct 257  Q
    |||||| ||||||||||||||| |||  || ||||||||||| ||| |||||| |||||||||| ||||    
16451154 tgaaaataagctgaaaacagctcatgaacaatgtcataagttgttttcataagttctcccaaacggtct 16451222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 163 - 247
Target Start/End: Complemental strand, 35379076 - 35378993
Alignment:
163 tttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcc 247  Q
    |||||||||||||  | |||||| ||||||||| |||||||||||| ||||||  || ||||| || | ||| ||||||||||||    
35379076 tttcataagctatcttggagagc-ttatgaaaataagctgaaaacaacttatgaacaagtcatcagctgttttcataagctctcc 35378993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 186 - 269
Target Start/End: Original strand, 38388718 - 38388802
Alignment:
186 cttatgaaaacaagctgaaaa-cagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgctta 269  Q
    |||||| ||| |||||||||| ||| |||||  ||||||||||||| || ||||||| |||||||||| |||  | |||||||||    
38388718 cttatggaaataagctgaaaaacagtttatgaacatgtcataagttgttaccataagttctcccaaacggtcacacaagtgctta 38388802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 236 - 292
Target Start/End: Complemental strand, 42852690 - 42852634
Alignment:
236 cataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||| ||||| ||||||||||| | ||||||||||| || |||||||| ||||||||    
42852690 cataggctcttccaaacagtctcacaagtgcttatgccagcagataagttcaaataa 42852634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 94; Significance: 1e-45; HSPs: 87)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 394 - 523
Target Start/End: Original strand, 53077738 - 53077867
Alignment:
394 ttaccttagtcttaggagcaagacctgccataagagcagcagcagcgttaccggcattattttcttcaatgaaactgatagtagagttgataaccaacaa 493  Q
    ||||||| ||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||    
53077738 ttacctttgtcttgggagcaagaccagccataagagctgcagcagcgttaccggcattattttcttcaatgaaactgatggtggagttgatcaccaacaa 53077837  T
494 gcaaataattcccacaaaatcttgccaatc 523  Q
    ||||||||| || |||||||||||||||||    
53077838 gcaaataatacctacaaaatcttgccaatc 53077867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 132 - 292
Target Start/End: Original strand, 2996552 - 2996711
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    |||||||||||| ||||||| |||||| || |||||||||||||  | |||||| | ||||||| ||| |||||| ||||||||  |||||||||||||     
2996552 tcaaattgtttttatataagttataagttgttttcataagctatcttggagagcgt-atgaaaataagttgaaaaaagcttatggacatgtcataagttg 2996650  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||| ||||||||||| |||||||||| ||||||||||||||||| | ||||| ||||||||    
2996651 ttttcataagctctctcaaacagtctcaaaagtgcttatgtcaataaataagttcaaataa 2996711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 132 - 292
Target Start/End: Original strand, 21157747 - 21157906
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||| ||||||||| ||||||||||| || ||||||| ||||| ||  ||||| ||||| ||| ||||| |||||||||| |||  |||||||||| |     
21157747 tcaaactgttttcatgtaagctataagatgttttcatatgctatcctgaagagc-ttatggaaataagctaaaaacagcttttgtaaatgtcataagctg 21157845  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||  |||||||| ||||||||||||| ||||||||||||||  |||| |||||||||||    
21157846 tttctgtaagctcttccaaacagtcttacaagtgcttatgtcagtagatgagctcaaataa 21157906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 132 - 292
Target Start/End: Original strand, 24091442 - 24091601
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||||| |||||||||||||||||| ||| ||||||||| ||| || || ||  ||||| |||||| ||||||||| || |||||||  |||||||||     
24091442 tcaaattattttcatataagctataaactgttttcataagttatcctgga-aggtttatggaaacaaactgaaaacaactaatgtgcaaatcataagttg 24091540  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||| ||||| ||||||| |   ||||| |||||| |  |||||| |||||||||    
24091541 tttccataagttctccaaaacagtttggcaagtgtttatgttagtagataaactcaaataa 24091601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 201 - 292
Target Start/End: Original strand, 27725261 - 27725352
Alignment:
201 tgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||| || |||||  ||||||||||||||||||||||||||||| ||||||||| || | |||||||| |||  ||||||||||||||||    
27725261 tgaaaatagtttatggacatgtcataagttatttccataagctctctcaaacagtcgtatatgtgcttatctcagtagataagctcaaataa 27725352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 185 - 292
Target Start/End: Original strand, 4691879 - 4691986
Alignment:
185 ccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagc 284  Q
    ||||||||||| |||||||||||| | |||| |||||||||||||| |||||||||| | || |||| ||||| | ||||| || || ||  ||||||||    
4691879 ccttatgaaaataagctgaaaacaacatatgggcatgtcataagttgtttccataagttttctcaaatagtctcacaagtgattgtgacagtagataagc 4691978  T
285 tcaaataa 292  Q
    ||||||||    
4691979 tcaaataa 4691986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 142 - 257
Target Start/End: Original strand, 11264290 - 11264404
Alignment:
142 ttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataag 241  Q
    |||||||| | |||||| || |||||||||| || ||||||||| ||||| ||| ||| ||||||||| |||||  |||||||||||||  ||| ||| |    
11264290 ttcatatatgttataagttgttttcataagccatcctagagagc-ttatggaaataagttgaaaacagtttatggacatgtcataagttgattctatatg 11264388  T
242 ctctcccaaacagtct 257  Q
    ||||||||||||||||    
11264389 ctctcccaaacagtct 11264404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 130 - 289
Target Start/End: Original strand, 28232522 - 28232680
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagt 229  Q
    ||||||||| ||| |||||||||||||| ||||||||| ||||||   | |||||| || || ||| ||| |||||||| |||||    | |||||||||    
28232522 aatcaaattatttccatataagctataaactgctttcagaagctaccttcgagagc-ttgtggaaataagatgaaaacaacttataaataagtcataagt 28232620  T
230 tatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaa 289  Q
    | |||||| ||||||| |||||||||||   ||||||| ||||||| ||||||| |||||    
28232621 tgtttccacaagctcttccaaacagtctcgcaagtgctcatgtcaatagataagttcaaa 28232680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 138 - 292
Target Start/End: Original strand, 44319934 - 44320087
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttcca 237  Q
    ||||||||||||||||| |||||  ||| ||||||||| ||||||| | |||||||||  || |||||| |||| |||   |  |||||| || ||| ||    
44319934 tgttttcatataagctacaagctattttgataagctatcctagagaac-ttatgaaaattagttgaaaatagctaatggatacatcataatttgttttca 44320032  T
238 taagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||||||||||| | || || ||||| ||| || |||||||||||||    
44320033 taagctctcccaaacagtctcacaattgtttatgccaataggtaagctcaaataa 44320087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 146 - 255
Target Start/End: Complemental strand, 6979039 - 6978931
Alignment:
146 tataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctct 245  Q
    |||| |||||||| || ||| |||||| || ||| ||||  ||||||||| ||||||||||||||||||   |||||||||||||||||| ||||| |||    
6979039 tatatgctataagttgtttttataagccatcctaaagagt-ttatgaaaataagctgaaaacagcttatagacatgtcataagttatttcaataagttct 6978941  T
246 cccaaacagt 255  Q
     |||||||||    
6978940 gccaaacagt 6978931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 134 - 256
Target Start/End: Original strand, 17884049 - 17884174
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg----tgcatgtcataagt 229  Q
    ||||||||||  |||||| ||| || || |||||||||||||| | |||||| |||||||||  ||||||||||| ||||||    | ||| ||||||||    
17884049 aaattgtttttgtataagttatcagttgttttcataagctatattggagagc-ttatgaaaattagctgaaaacaacttatgaacatacatttcataagt 17884147  T
230 tatttccataagctctcccaaacagtc 256  Q
    |||||||||||| |||||| |||||||    
17884148 tatttccataagttctcccgaacagtc 17884174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 291
Target Start/End: Complemental strand, 18628555 - 18628486
Alignment:
222 tcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaata 291  Q
    ||||||||| ||| |||||||||||||||||||||| | ||||| ||||||||  |||||||||||||||    
18628555 tcataagttgttttcataagctctcccaaacagtctcacaagtgtttatgtcagtagataagctcaaata 18628486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 147 - 255
Target Start/End: Original strand, 1137706 - 1137813
Alignment:
147 ataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctc 246  Q
    |||| ||||||||||||||||||| |||| | ||||||| ||||| ||| || ||||||||| ||||||  ||||||||||| | ||| |||||| ||||    
1137706 ataatctataagctgctttcataaactatccaagagagc-ttatggaaataaactgaaaacaacttatgaacatgtcataagatgttttcataagttctc 1137804  T
247 ccaaacagt 255  Q
    | |||||||    
1137805 ctaaacagt 1137813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 140 - 292
Target Start/End: Original strand, 53315313 - 53315464
Alignment:
140 ttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccata 239  Q
    |||||||||||||||||||||| | ||| || | |  ||||||||| ||||||||| ||| | |||| ||||||||  ||||| ||| ||| ||| ||||    
53315313 ttttcatataagctataagctgttctcaaaaacaaacctagagagc-ttatgaaaataagttaaaaatagcttatggacatgtgatatgttgttttcata 53315411  T
240 agctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||| |||| ||||||| | ||||||||  ||   |||||||||||||||    
53315412 agctctcacaaatagtcttatatgtgcttataccagtggataagctcaaataa 53315464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 132 - 271
Target Start/End: Complemental strand, 7694101 - 7693964
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||| ||||||  |||||||||||||||| ||||||||| ||| || |||||  ||||| ||| |||||||||||| ||||||  |||||||| |  ||    
7694101 tcaaactgtttttgtataagctataagctgttttcataagttatcctggagag-tttatggaaataagctgaaaacaacttatgaacatgtcattaacta 7694003  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatg 271  Q
    ||| |||||| | || |||||| ||||| |||||||||||    
7694002 ttt-cataagttttcacaaacaatcttagaagtgcttatg 7693964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 132 - 255
Target Start/End: Original strand, 10192263 - 10192388
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg----tgcatgtcataa 227  Q
    |||||||||||||||||||| |||||| || ||||| ||||||| || ||||||  |||||||| ||| |||||||| |||| |    ||||||| ||||    
10192263 tcaaattgttttcatataagttataagttgttttcaaaagctatcctggagagc--tatgaaaataagttgaaaacaacttacgaacatgcatgttataa 10192360  T
228 gttatttccataagctctcccaaacagt 255  Q
    |||||||  ||||| |||| ||||||||    
10192361 gttatttttataagttctctcaaacagt 10192388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 193 - 292
Target Start/End: Original strand, 19304965 - 19305064
Alignment:
193 aaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||||||| ||||||  ||||||||||| | |||||| ||  ||||||| ||| ||| | || |||||||||||| |||||| |||||||||    
19304965 aaacaagctgaaaacaacttatggacatgtcataagctgtttccacaaattctcccacacaatctcacaaatgcttatgtcaatagataatctcaaataa 19305064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 130 - 213
Target Start/End: Complemental strand, 30207664 - 30207582
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagctta 213  Q
    ||||||| ||||||||||||||||||||| || ||||||||||||   |||||||  ||||| ||| |||||||||||||||||    
30207664 aatcaaactgttttcatataagctataagttgttttcataagctaccttagagag-attatggaaataagctgaaaacagctta 30207582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 132 - 257
Target Start/End: Complemental strand, 7368147 - 7368021
Alignment:
132 tcaaattgttttcatataagc-tataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtt 230  Q
    ||||||||||||||||||||| |||||| || || |||||||||| ||||||||| |    |||| | | ||||| ||||||||   ||||||||||| |    
7368147 tcaaattgttttcatataagcttataagttgtttccataagctattctagagagcttacaaaaaatatgttgaaagcagcttataaacatgtcataagct 7368048  T
231 atttccataagctctcccaaacagtct 257  Q
     ||| ||| ||||||||||||||||||    
7368047 gttttcatgagctctcccaaacagtct 7368021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 167 - 257
Target Start/End: Complemental strand, 19394819 - 19394730
Alignment:
167 ataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    |||||||||||||||||| |||||| ||| |||||| |  |||||||||| ||||| ||||||| |||| |||||||||  ||||||||||    
19394819 ataagctatactagagag-cttatggaaataagctgtattcagcttatgtacatgtaataagttgtttctataagctctggcaaacagtct 19394730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 138 - 240
Target Start/End: Original strand, 24929478 - 24929579
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttcca 237  Q
    |||||||||| |||||||||| || |||||||| || |||||||||| |||||| ||| ||||||||||||  |||||  |||| |||||| | ||||||    
24929478 tgttttcataaaagctataagttgttttcataaactctactagagag-cttatggaaataagctgaaaacaatttatgaacatgccataagctgtttcca 24929576  T
238 taa 240  Q
    |||    
24929577 taa 24929579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 186 - 292
Target Start/End: Complemental strand, 33534207 - 33534101
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    |||||||||| |||||||||||| ||||||   |||||| || || ||| ||||||||||| |||| | ||| | |||| |||||||||  |||||||||    
33534207 cttatgaaaataagctgaaaacaacttatggatatgtcacaatttgttttcataagctctctcaaatactctcacaagtacttatgtcactagataagct 33534108  T
286 caaataa 292  Q
    |||||||    
33534107 caaataa 33534101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 218 - 291
Target Start/End: Complemental strand, 8328125 - 8328052
Alignment:
218 catgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaata 291  Q
    |||||||||| || ||| |||||||| | ||||||||||| | ||||||||||| ||| |||||||||||||||    
8328125 catgtcataaattgttttcataagctattccaaacagtctcataagtgcttatgccaatagataagctcaaata 8328052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 186 - 271
Target Start/End: Original strand, 42461283 - 42461368
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatg 271  Q
    |||||||||| ||||||||| || ||||||  || |||||| | ||||| |||||| ||||||||||||||| | |||||||||||    
42461283 cttatgaaaataagctgaaatcaacttatgaacacgtcataggctattttcataagttctcccaaacagtctcataagtgcttatg 42461368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 135 - 215
Target Start/End: Original strand, 8468930 - 8469009
Alignment:
135 aattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg 215  Q
    |||| |||||||||||||||| || || ||||||||| ||| |||||||| |||||||||| || ||||||||| ||||||    
8468930 aatttttttcatataagctattagttgttttcataagttattctagagag-cttatgaaaataatctgaaaacaacttatg 8469009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 131 - 251
Target Start/End: Complemental strand, 46415884 - 46415765
Alignment:
131 atcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtt 230  Q
    |||||| |||||||||| ||| |||||| |  ||||||||||||| || |||||| |||  ||||  ||||||||||| ||||||  ||||||||| |||    
46415884 atcaaactgttttcatacaagttataagttcttttcataagctatcctcgagagc-ttagtaaaattagctgaaaacaacttatggacatgtcataggtt 46415786  T
231 atttccataagctctcccaaa 251  Q
     ||| ||||| ||||||||||    
46415785 gtttgcataaactctcccaaa 46415765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 134 - 253
Target Start/End: Complemental strand, 50800118 - 50800001
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatt 233  Q
    |||||| |||| |||||||||||||||| |||| ||||||||  | |||| | ||  | ||| ||||||||||||||||||   ||||||||||||| ||    
50800118 aaattgctttcttataagctataagctgttttcttaagctatcatggagaacttt--ggaaataagctgaaaacagcttatagacatgtcataagttgtt 50800021  T
234 tccataagctctcccaaaca 253  Q
    | ||| || |||||||||||    
50800020 tacattagttctcccaaaca 50800001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 186 - 257
Target Start/End: Complemental strand, 6987779 - 6987708
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    |||||| ||| ||| |||||| || |||||  ||||||||||||| | ||||||||||||||||||||||||    
6987779 cttatggaaataagttgaaaatagtttatggacatgtcataagttgtatccataagctctcccaaacagtct 6987708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 153 - 268
Target Start/End: Original strand, 9680671 - 9680785
Alignment:
153 tataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaac 252  Q
    ||||||||||||||||||||||| || || || ||| |||||| | |||||||||| ||||||  ||| ||||||| | |||  ||| ||||| ||| ||    
9680671 tataagctgctttcataagctatcctggaaag-cttttgaaaaaacgctgaaaacaacttatggacatatcataagctgtttttatatgctcttccatac 9680769  T
253 agtcttaaaagtgctt 268  Q
    ||||||| ||||||||    
9680770 agtcttacaagtgctt 9680785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 132 - 292
Target Start/End: Complemental strand, 24371044 - 24370883
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtg--catgtcataagt 229  Q
    |||||||| ||| | | |||||||||| || ||||||||||||| ||| | ||  ||||  ||| ||||||||||| ||||||||   ||||||||||||    
24371044 tcaaattgcttttacaaaagctataagttgttttcataagctatcctaaatagt-ttatagaaataagctgaaaacggcttatgtatacatgtcataagt 24370946  T
230 tatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    | |||||||||| | |  |||||| ||| | | |||||||||  || ||||||||||||||||    
24370945 tgtttccataagttttatcaaacattctcacatgtgcttatgcgaatagataagctcaaataa 24370883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 197 - 292
Target Start/End: Original strand, 25583635 - 25583730
Alignment:
197 aagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||| ||| ||  ||||||||||||| ||| ||||||| |||||||||||||| | |  || ||||||||  |||||| |||||||||    
25583635 aagctgaaaacaacttttggacatgtcataagttgtttgcataagcgctcccaaacagtctcacacatgtttatgtcagaagataaactcaaataa 25583730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 130 - 253
Target Start/End: Complemental strand, 45128403 - 45128281
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagt 229  Q
    ||||||||| || |||||||||||||||  || |||||||| || | ||| | ||| ||||| ||| ||||||||||||||| |||  ||||  || |||    
45128403 aatcaaattattctcatataagctataaattgttttcataaactgtcctataaagc-ttatggaaataagctgaaaacagctcatggacatgatatcagt 45128305  T
230 tatttccataagctctcccaaaca 253  Q
    | ||||||||||||||| ||||||    
45128304 tgtttccataagctctctcaaaca 45128281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 201 - 292
Target Start/End: Original strand, 50298563 - 50298653
Alignment:
201 tgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||||||  ||||||||||| |||||  ||||| | | ||||||||||| | ||||||||||||||  ||||||||| ||||||    
50298563 tgaaaacagcttatgaacatgtcataagctatttt-ataagtttttccaaacagtctcacaagtgcttatgtcagtagataagctaaaataa 50298653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 163 - 257
Target Start/End: Complemental strand, 4798626 - 4798533
Alignment:
163 tttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    |||||||||||||  | |||||| ||||| ||| ||||| |||||||||||||| ||||||| |||   |||||||||||||| || ||||||||    
4798626 tttcataagctatcttggagagc-ttatgcaaataagctcaaaacagcttatgtacatgtcagaagccgtttccataagctcttcctaacagtct 4798533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 163 - 257
Target Start/End: Complemental strand, 21043295 - 21043202
Alignment:
163 tttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    ||||||||||||| ||  ||||| | ||||||| |  ||||||||||||||||  | ||||||||| | ||||||||| ||||||||||||||||    
21043295 tttcataagctatcctgaagagcat-atgaaaatacactgaaaacagcttatgaacgtgtcataagctgtttccataacctctcccaaacagtct 21043202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 167 - 245
Target Start/End: Complemental strand, 28614864 - 28614787
Alignment:
167 ataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctct 245  Q
    ||||||||| ||||||| | ||||||||| |||||||||| ||||||||   ||||||||| || ||||||||||||||    
28614864 ataagctatcctagagaac-ttatgaaaataagctgaaaagagcttatggatatgtcataaattgtttccataagctct 28614787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 136 - 257
Target Start/End: Original strand, 29263353 - 29263474
Alignment:
136 attgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttc 235  Q
    |||||||||| |||||| ||||| || ||||||||||||| ||  |||| ||| || ||| |||||||||||| ||||||  ||| ||||||| | ||||    
29263353 attgttttcaaataagcgataagttgttttcataagctatcctgcagag-cttgtggaaataagctgaaaacaacttatgaacatatcataagctgtttc 29263451  T
236 ca-taagctctcccaaacagtct 257  Q
     | ||||||||||||| ||||||    
29263452 aattaagctctcccaagcagtct 29263474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 186 - 292
Target Start/End: Original strand, 47970328 - 47970434
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagct 285  Q
    |||||| ||| ||||||||||||  |||||   |||||| ||||  |||||||||||| |||  |||||| | | ||||||||||||||  |||||||||    
47970328 cttatgcaaataagctgaaaacaatttatggaaatgtcacaagtagtttccataagctttccataacagtttcacaagtgcttatgtcagtagataagct 47970427  T
286 caaataa 292  Q
    |||||||    
47970428 caaataa 47970434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 208 - 257
Target Start/End: Complemental strand, 19429528 - 19429479
Alignment:
208 agcttatgtgcatgtcataagttatttccataagctctcccaaacagtct 257  Q
    ||||||||  ||||||||||||| | ||||||||||||||||||||||||    
19429528 agcttatggacatgtcataagttttctccataagctctcccaaacagtct 19429479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 20031730 - 20031810
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctg-aaaacagcttat 214  Q
    ||||||||||||| |||||||||||| | |||||||||||||  ||||||  ||||||||||  ||||| ||||||||||||    
20031730 aaattgttttcatgtaagctataagcagttttcataagctattttagaga-acttatgaaaatgagctgaaaaacagcttat 20031810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 130 - 175
Target Start/End: Original strand, 20907324 - 20907369
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctat 175  Q
    |||||||||||||||||||||||||||| ||| ||||| |||||||    
20907324 aatcaaattgttttcatataagctataaactgttttcacaagctat 20907369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 186 - 292
Target Start/End: Original strand, 25896812 - 25896922
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtg----catgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagata 281  Q
    |||| ||||| ||||||||||||| ||||||     ||||||||||| |||||| ||||||||||| ||||||||| | ||||||| |||  |  |||||    
25896812 cttaggaaaataagctgaaaacagtttatgtatggacatgtcataagctatttctataagctctcctaaacagtctcacaagtgctaatgctagtagata 25896911  T
282 agctcaaataa 292  Q
    | |||||||||    
25896912 aactcaaataa 25896922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 218 - 271
Target Start/End: Complemental strand, 27123358 - 27123305
Alignment:
218 catgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatg 271  Q
    ||||||||||||| ||||||||||||||| |||||||||| | |||| ||||||    
27123358 catgtcataagttgtttccataagctctctcaaacagtctcacaagtacttatg 27123305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 130 - 175
Target Start/End: Original strand, 36823976 - 36824020
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctat 175  Q
    ||||||||||||||||||||||| |||||||| |||||||||||||    
36823976 aatcaaattgttttcatataagc-ataagctgatttcataagctat 36824020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 201 - 294
Target Start/End: Complemental strand, 41097279 - 41097187
Alignment:
201 tgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataact 294  Q
    |||||| ||||||||  |||||||| |||| |||| |||||||||||| |||||||| | |||||||| || | | ||||||| ||||||||||    
41097279 tgaaaatagcttatggacatgtcattagttgtttctataagctctcccgaacagtctcacaagtgcttttgac-atagataagttcaaataact 41097187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 130 - 291
Target Start/End: Original strand, 43824260 - 43824420
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagt 229  Q
    ||||||||| |||||||||||| ||||||||  |||| |||| ||| || || || |||||| ||| |||||||||||| ||||||  |||| ||||||     
43824260 aatcaaattcttttcatataagttataagcttttttcgtaagttatcctggaaag-cttatggaaataagctgaaaacaacttatgaacatgccataagc 43824358  T
230 tatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaata 291  Q
     ||||  |||   ||||||||||| | |   ||||||||||||||  | |||||||||||||    
43824359 catttttatatattctcccaaacaatatcgcaagtgcttatgtcagtaaataagctcaaata 43824420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 187 - 292
Target Start/End: Original strand, 45927382 - 45927487
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctc 286  Q
    ||||| ||| ||||||||||||||||||| | ||||||| | || |||||| ||||| |   ||||||||| ||||| | |||||| || |||||| |||    
45927382 ttatggaaataagctgaaaacagcttatgcgtatgtcatgaattgtttccacaagctttgtgaaacagtctcaaaagggtttatgttaatagataaactc 45927481  T
287 aaataa 292  Q
    ||||||    
45927482 aaataa 45927487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 197 - 270
Target Start/End: Original strand, 46797057 - 46797130
Alignment:
197 aagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttat 270  Q
    ||||| |||| ||||||||||||||||| ||| |||||| ||||||| ||  ||||||||| | ||||||||||    
46797057 aagctaaaaagagcttatgtgcatgtcacaagctatttcaataagctttcataaacagtctcacaagtgcttat 46797130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 134 - 239
Target Start/End: Complemental strand, 52746929 - 52746825
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatt 233  Q
    ||||||||||  | ||||| |||||||| ||||||||||||| || |  || ||||||||||  ||||||||||||||||||  |||||| |||| | ||    
52746929 aaattgtttttgtgtaagccataagctgttttcataagctat-cttgtaaggcttatgaaaatcagctgaaaacagcttatgaacatgtcttaagctgtt 52746831  T
234 tccata 239  Q
    ||||||    
52746830 tccata 52746825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 51 - 115
Target Start/End: Original strand, 7730513 - 7730577
Alignment:
51 tttggataaacatcgtaatcaagcacttataatataaatgtttgcgtacaagttatttctataat 115  Q
    |||||||||||| | |||| |||||||||| ||||||||||||   |||||||||||| ||||||    
7730513 tttggataaacaacttaattaagcacttattatataaatgtttatctacaagttatttttataat 7730577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 203 - 251
Target Start/End: Original strand, 21952997 - 21953045
Alignment:
203 aaaacagcttatgtgcatgtcataagttatttccataagctctcccaaa 251  Q
    ||||||| |||||  ||||||||||||| ||||||||||||||||||||    
21952997 aaaacaggttatggacatgtcataagttctttccataagctctcccaaa 21953045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 138 - 214
Target Start/End: Original strand, 36048518 - 36048593
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttat 214  Q
    |||||||||||||||||||||||  ||||| |||||||  ||||||| |||||| ||| ||||||| || |||||||    
36048518 tgttttcatataagctataagctattttcaaaagctatcttagagag-cttatggaaataagctgacaatagcttat 36048593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 174
Target Start/End: Original strand, 40174544 - 40174584
Alignment:
134 aaattgttttcatataagctataagctgctttcataagcta 174  Q
    |||||||||||||| ||||||||||||| ||||||||||||    
40174544 aaattgttttcataaaagctataagctgttttcataagcta 40174584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 131 - 271
Target Start/End: Original strand, 42866046 - 42866185
Alignment:
131 atcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtt 230  Q
    |||||| |||||| |||||||||||||| || ||||||||||||| || ||||| |||||| ||  ||||| ||| || ||||||  ||| |||||   |    
42866046 atcaaactgtttttatataagctataagttgttttcataagctatccttgagag-cttatggaagtaagctaaaagcatcttatggacatatcatagaat 42866144  T
231 atttccataagctctcccaaacagtcttaaaagtgcttatg 271  Q
     ||| |||||| ||||||||| ||||| ||| ||| |||||    
42866145 gtttacataagttctcccaaagagtctcaaaggtgtttatg 42866185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 132 - 172
Target Start/End: Original strand, 53626755 - 53626795
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagc 172  Q
    ||||| |||||||||||||||||||||||| ||||||||||    
53626755 tcaaaatgttttcatataagctataagctgttttcataagc 53626795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 132 - 215
Target Start/End: Original strand, 11802513 - 11802595
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg 215  Q
    ||||||| || ||| |||||||| ||| || |||||||||||||  | |||||| |||||| || |||||||||||||||||||    
11802513 tcaaatttttctcacataagctacaagttgttttcataagctattatggagagc-ttatgagaataagctgaaaacagcttatg 11802595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 187 - 274
Target Start/End: Original strand, 18011904 - 18011991
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtca 274  Q
    ||||||||| ||||| ||||| |||||| | ||| | ||||| | ||| ||||||||||||| ||| |||| | ||||||||||||||    
18011904 ttatgaaaataagctaaaaacggcttatatacatattataagctgttttcataagctctcccgaacggtctcagaagtgcttatgtca 18011991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 49 - 120
Target Start/End: Original strand, 19422314 - 19422385
Alignment:
49 tgtttggataaacatcgtaatcaagcacttataatataaatgtttgcgtacaagttatttctataataaaag 120  Q
    |||||||||||||| | |||| |||| ||||| ||||||||| ||  ||| ||||||||||||||| |||||    
19422314 tgtttggataaacagcttaattaagcgcttatcatataaatgcttatgtataagttatttctataacaaaag 19422385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 221 - 292
Target Start/End: Original strand, 25717660 - 25717731
Alignment:
221 gtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||| |||||||||||||| ||||||| | | | |||||||||||||   | ||||||||||||||    
25717660 gtcataagttgtttccataagctcttccaaacaatttcacaagtgcttatgtcggtacataagctcaaataa 25717731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 136 - 215
Target Start/End: Complemental strand, 30066853 - 30066775
Alignment:
136 attgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg 215  Q
    ||||||||| ||||| || ||||||| | |||||||||||  | |||||| |||| |||||||||||||||||| |||||    
30066853 attgttttcgtataaactgtaagctgttctcataagctatcttggagagc-ttataaaaacaagctgaaaacagattatg 30066775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 136 - 175
Target Start/End: Complemental strand, 35571718 - 35571679
Alignment:
136 attgttttcatataagctataagctgctttcataagctat 175  Q
    ||||||||| |||||||||||||||| |||||||||||||    
35571718 attgttttcgtataagctataagctgttttcataagctat 35571679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 132 - 215
Target Start/End: Original strand, 49219118 - 49219200
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatg 215  Q
    ||||||| ||||||||||||||||||| || |||||||| ||||  || ||||  ||||| ||| |||||||||||| ||||||    
49219118 tcaaattattttcatataagctataagttgttttcataaactatcttaaagag-attatggaaataagctgaaaacaacttatg 49219200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 218 - 292
Target Start/End: Original strand, 6428082 - 6428156
Alignment:
218 catgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||||||||| ||| ||||| ||||| ||||| |||| | ||||||||||  ||| | ||||||||||||||    
6428082 catgtcataagttgttttcataatctctctcaaactgtctcacaagtgcttataccaatatataagctcaaataa 6428156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 238 - 292
Target Start/End: Original strand, 28615608 - 28615662
Alignment:
238 taagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||| | ||||||||||| || |||||||||||  ||||||||||||||||    
28615608 taagctcttcgaaacagtcttacaaatgcttatgtcattagataagctcaaataa 28615662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 130 - 184
Target Start/End: Complemental strand, 35517226 - 35517172
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctatactagagag 184  Q
    |||||||||||||| |||||||||| ||| || ||||||||||||| || |||||    
35517226 aatcaaattgtttttatataagctagaagatgttttcataagctatcctggagag 35517172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 138 - 172
Target Start/End: Original strand, 36460571 - 36460605
Alignment:
138 tgttttcatataagctataagctgctttcataagc 172  Q
    |||||||||||||||||||||||| ||||||||||    
36460571 tgttttcatataagctataagctgttttcataagc 36460605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 134 - 212
Target Start/End: Complemental strand, 53294203 - 53294126
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagctt 212  Q
    ||||||||||  |||| |||||||| || ||| |||| ||||| |||||| | |||||||||||||||||||| |||||    
53294203 aaattgtttttgtatatgctataagttgtttttataaactatattagagaac-ttatgaaaacaagctgaaaatagctt 53294126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 203
Target Start/End: Complemental strand, 437521 - 437453
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctga 203  Q
    ||||||| |||||||||| | |||| || |||||||||||||  ||||| |||||||||||| |||||||    
437521 aaattgtgttcatataagttttaagttgttttcataagctattttagag-gccttatgaaaataagctga 437453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 187 - 292
Target Start/End: Complemental strand, 3176141 - 3176036
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctc 286  Q
    ||||| ||| |||||||||||| |||||   |||| |||||| | ||| |||||||||||| ||||||| | | ||||| || || ||||| ||||||||    
3176141 ttatggaaataagctgaaaacaacttatagacatgacataagatgttttcataagctctcctaaacagtttcacaagtgtttgtgccaacatataagctc 3176042  T
287 aaataa 292  Q
     |||||    
3176041 gaataa 3176036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 19154723 - 19154776
Alignment:
130 aatcaaattgttttcatataagctataagctgctttcataagctatactagaga 183  Q
    |||||||||| ||||||||||||||||| ||| ||||||| | ||| |||||||    
19154723 aatcaaattgctttcatataagctataaactgttttcatacggtatcctagaga 19154776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 241
Target Start/End: Complemental strand, 20936320 - 20936212
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    |||||||||||| |||||| ||||| | || |||||||  |||| || |||||  ||||| ||| ||| |||||||||||||||  ||| |||||||||     
20936320 tcaaattgtttttatataatctataggttgttttcatattctatcctggagaga-ttatggaaataaggtgaaaacagcttatgaacatatcataagttg 20936222  T
232 tttccataag 241  Q
    ||| ||||||    
20936221 ttttcataag 20936212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 132 - 257
Target Start/End: Original strand, 23819068 - 23819192
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||| |||||||||||||| |||||  || |||||||||||||  |  |||| |||||  ||| ||| |||||||| ||||||  ||||||||||| |     
23819068 tcaaactgttttcatataagttataacatgttttcataagctatcttgaagag-cttatagaaataagatgaaaacaacttatggacatgtcataagctg 23819166  T
232 tttccataagctctcccaaacagtct 257  Q
    ||| | ||| |||| |||||||||||    
23819167 ttttcttaaactcttccaaacagtct 23819192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 153 - 246
Target Start/End: Original strand, 27721717 - 27721809
Alignment:
153 tataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctc 246  Q
    ||||||||| ||||||||| ||| || |||||| ||  ||||| |||||||||||||||||||   |||||||||||  |||  ||||||||||    
27721717 tataagctgttttcataagttatcctggagagc-ttgcgaaaataagctgaaaacagcttatggatatgtcataagtagtttttataagctctc 27721809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 140 - 209
Target Start/End: Complemental strand, 29601091 - 29601023
Alignment:
140 ttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacag 209  Q
    |||||||  ||||||||| ||| ||||||| ||||| ||||||| | ||||||||| |||||||||||||    
29601091 ttttcatgcaagctataatctgttttcatatgctatcctagagaac-ttatgaaaataagctgaaaacag 29601023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 187 - 292
Target Start/End: Complemental strand, 51560326 - 51560221
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctc 286  Q
    |||||| || ||||| ||||||  |||||  ||||| ||||| | ||| |||||| ||||||||| ||||| | ||||||||||| ||  ||||||||||    
51560326 ttatgagaataagctaaaaacaagttatgaacatgtgataaggtgttttcataaggtctcccaaagagtctcataagtgcttatgccagtagataagctc 51560227  T
287 aaataa 292  Q
    | ||||    
51560226 atataa 51560221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 134 - 175
Target Start/End: Original strand, 51630092 - 51630133
Alignment:
134 aaattgttttcatataagctataagctgctttcataagctat 175  Q
    |||||||||| ||||||||||||||||  |||||||||||||    
51630092 aaattgttttgatataagctataagctattttcataagctat 51630133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 142 - 214
Target Start/End: Original strand, 6364138 - 6364209
Alignment:
142 ttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttat 214  Q
    |||| |||||||||||||   |||||||||||||| | |||| | ||| ||||| ||||||||||||||||||    
6364138 ttcacataagctataagcaattttcataagctataatggagaac-ttacgaaaataagctgaaaacagcttat 6364209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 232 - 292
Target Start/End: Original strand, 9316603 - 9316663
Alignment:
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||||||||||||||| | | ||||| |||||| ||  ||| |||||||||||    
9316603 tttccataagctctcccaaacagtttcacaagtgtttatgtaaatggatgagctcaaataa 9316663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 136 - 292
Target Start/End: Original strand, 10172045 - 10172200
Alignment:
136 attgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttc 235  Q
    |||||||||||||||||| |||  || ||||||||| ||| | | ||||| |||||| || ||||   ||||| | ||||  ||||||| ||| | ||||    
10172045 attgttttcatataagctttaaaatgttttcataagttatccaaaagagc-ttatgagaataagccataaacaacctatgaacatgtcacaagctgtttc 10172143  T
236 cataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||| |  |||||||| | | |||||||||||   | ||||||||||||||||    
10172144 cataagctatatcaaacagtttcacaagtgcttatgcatatagataagctcaaataa 10172200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 145 - 289
Target Start/End: Original strand, 14011226 - 14011369
Alignment:
145 atataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctc 244  Q
    |||||||||| ||  || || ||||||||||  | |||||| ||||| ||| |||||||||||||||||    ||||| ||||  | ||| |||||||||    
14011226 atataagctacaaaatgtttacataagctatcttggagagc-ttatggaaataagctgaaaacagcttaaagacatgtgataaactctttgcataagctc 14011324  T
245 tcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaa 289  Q
    ||||||| ||| ||| | |||||||||| |  ||||||| |||||    
14011325 tcccaaatagttttacatgtgcttatgtaagtagataagttcaaa 14011369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 232 - 288
Target Start/End: Original strand, 20521581 - 20521637
Alignment:
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaa 288  Q
    ||||||||| |||||| ||||||||| | ||||||||| | || |||||||||||||    
20521581 tttccataaactctcctaaacagtctcagaagtgcttaagacagcagataagctcaa 20521637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 132 - 160
Target Start/End: Original strand, 21952940 - 21952968
Alignment:
132 tcaaattgttttcatataagctataagct 160  Q
    |||||||||||||||||||||||||||||    
21952940 tcaaattgttttcatataagctataagct 21952968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 236 - 292
Target Start/End: Complemental strand, 25487545 - 25487489
Alignment:
236 cataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||| ||||||| ||||| |||||||||||  || |||||| |||||||||    
25487545 cataagctcttccaaacaatcttacaagtgcttatgctaatagataaactcaaataa 25487489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 187 - 243
Target Start/End: Complemental strand, 28749944 - 28749888
Alignment:
187 ttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagct 243  Q
    |||||||||  || ||||||||| |||||  ||||| ||||||||||||||||||||    
28749944 ttatgaaaatgagttgaaaacagtttatggacatgtaataagttatttccataagct 28749888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 220 - 292
Target Start/End: Original strand, 29375969 - 29376041
Alignment:
220 tgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||||| | |||||||||||||||  ||| ||  | | ||||||||||||||| ||||||| ||||||||    
29375969 tgtcataagctgtttccataagctctctgaaatagcgtcacaagtgcttatgtcaatagataagttcaaataa 29376041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 174
Target Start/End: Original strand, 29778776 - 29778816
Alignment:
134 aaattgttttcatataagctataagctgctttcataagcta 174  Q
    |||||||||||||||||||| |||| || ||||||||||||    
29778776 aaattgttttcatataagctgtaagttgttttcataagcta 29778816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 236 - 292
Target Start/End: Original strand, 46860000 - 46860056
Alignment:
236 cataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    ||||||||||| |||||||| | | |||||||||||| || ||||||| ||||||||    
46860000 cataagctctctcaaacagtttcacaagtgcttatgtgaatagataagttcaaataa 46860056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 67; Significance: 2e-29; HSPs: 64)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 132 - 274
Target Start/End: Complemental strand, 281939 - 281798
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    |||| |||||||||||||||||||||||||  |||||||||||| ||||||||| | ||| ||| |||||||||||| |||||   |||||||||||||     
281939 tcaacttgttttcatataagctataagctgtgttcataagctatcctagagagc-tcatggaaataagctgaaaacaacttatagacatgtcataagttg 281841  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtca 274  Q
     |||||| |||||||||||||||||| | |||| |||||||||    
281840 cttccattagctctcccaaacagtctcacaagtacttatgtca 281798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 138 - 255
Target Start/End: Complemental strand, 4247146 - 4247030
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttcca 237  Q
    |||||||||||||| ||||||||| ||||||||| | | ||||| || |||||||||||||||||||||||| |||||  ||||||||||  |||||||     
4247146 tgttttcatataagttataagctgttttcataagttgtcctaga-aggcttatgaaaacaagctgaaaacagattatgaacatgtcataaactatttcct 4247048  T
238 taagctctcccaaacagt 255  Q
    ||| |||||| |||||||    
4247047 taacctctcctaaacagt 4247030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 132 - 292
Target Start/End: Complemental strand, 8420288 - 8420129
Alignment:
132 tcaaattgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagtta 231  Q
    ||||| ||| || ||||||  ||||||||| | || ||||||||| | |||||| ||||| ||| ||| |||||| ||||| ||  ||||||||||| ||    
8420288 tcaaactgtgtttatataaaatataagctgttctcgtaagctataatggagagc-ttatggaaataagttgaaaatagcttgtggacatgtcataagcta 8420190  T
232 tttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||| |||||||||| | |||||||| | ||||| ||||||||| ||||||||||||||||    
8420189 tttctataagctctcactaacagtctcacaagtgtttatgtcaatagataagctcaaataa 8420129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 186 - 272
Target Start/End: Original strand, 9027610 - 9027696
Alignment:
186 cttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgt 272  Q
    |||||||||| |||||||||||| ||||||  ||||||||||||||||||||||||||||  ||||||| |||  | ||||||||||    
9027610 cttatgaaaataagctgaaaacaacttatggacatgtcataagttatttccataagctctttcaaacagacttgcacgtgcttatgt 9027696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 218 - 292
Target Start/End: Original strand, 30865547 - 30865621
Alignment:
218 catgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||||||||||||||||||||  |||| |||| | ||||| |||||| |||||||||||||||||||    
30865547 catgtcataagttatttccataagctctcttaaactgtctaacaagtgtttatgttaacagataagctcaaataa 30865621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 136 - 292
Target Start/End: Complemental strand, 28088309 - 28088155
Alignment:
136 attgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttc 235  Q
    |||||||||||||||||||||| ||| |||||||||||||  | ||||| || ||| ||| ||||| |||||| | |||   ||||| ||||||| ||||    
28088309 attgttttcatataagctataaactgttttcataagctatcatggagag-ctcatggaaataagctcaaaacaacctatagacatgt-ataagttgtttc 28088212  T
236 cataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||  | |||||| |||| ||||||| |||| |||| | ||||||||||||||    
28088211 cataagccattccaaactgtctcaaaagtggttatatcaataaataagctcaaataa 28088155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 197 - 292
Target Start/End: Original strand, 30863289 - 30863384
Alignment:
197 aagctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||| ||||||| ||||||||||||| ||| |||||||||| ||||| ||||| | ||||| ||||| ||| | ||| ||||||||||    
30863289 aagctgaaaacaacttatgtacatgtcataagttgttttcataagctctaccaaagagtctaacaagtgtttatgccaataaataggctcaaataa 30863384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 198 - 292
Target Start/End: Complemental strand, 1669824 - 1669730
Alignment:
198 agctgaaaacagcttatgtgcatgtcataagttatttccataagctctcccaaacagtcttaaaagtgcttatgtcaacagataagctcaaataa 292  Q
    |||||||||||||||||   ||||||||||||| ||| |||||||||||||||  ||||||| |||||| |||| ||| | |||||| |||||||    
1669824 agctgaaaacagcttatagacatgtcataagttgttttcataagctctcccaattagtcttacaagtgcatatgacaaaaaataagcacaaataa 1669730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 138 - 244
Target Start/End: Original strand, 4246395 - 4246500
Alignment:
138 tgttttcatataagctataagctgctttcataagctatactagagagccttatgaaaacaagctgaaaacagcttatgtgcatgtcataagttatttcca 237  Q
    ||||||||||||| |||||||||| |||||||||||||  | ||||| | ||| |||| ||| |||||||||||||||  |||||||| |||| ||||||    
4246395 tgttttcatataatctataagctgttttcataagctattatggagag-catataaaaataagttgaaaacagcttatggacatgtcatgagttgtttcca 4246493  T
238 taagctc 244  Q
     ||||||