View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk23-7 (Length: 142)

Name: R108-tnk23-7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] R108-tnk23-7
[»] chr2 (1 HSPs)
chr2 (1-131)||(1622674-1622804)

Alignment Details
Target: chr2 (Bit Score: 131; Significance: 2e-68; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 1622674 - 1622804
1 aattctcctatattaaagacgaatttcctctgtacaccagagttggagattgtactcatgctcacttatttaaatgatcaaagtctttttaacaattgaa 100  Q
1622674 aattctcctatattaaagacgaatttcctctgtacaccagagttggagattgtactcatgctcacttatttaaatgatcaaagtctttttaacaattgaa 1622773  T
101 ccaatcctatttttagtatttatcacatatt 131  Q
1622774 ccaatcctatttttagtatttatcacatatt 1622804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 315377 times since January 2019
Visitors: 447