View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk44-1 (Length: 238)

Name: R108-tnk44-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk44-1
R108-tnk44-1
[»] chr2 (1 HSPs)
chr2 (1-238)||(6387794-6388028)


Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 6387794 - 6388028
Alignment:
1 gaaacaaagcaaaggtgcaagtaaggaagaaagcactgaaatattctagtaaatagaagacttgatgaaaacagaacccatgaaattaaatataacatgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||    
6387794 gaaacaaagcaaaggtgcaagtaaggaagaaagcactgaaatattctagtaaatagaagaattgatgaaaacagaacc-atgaaattaaatataacatgc 6387892  T
101 tggcaaacccttgcaaacagagaactgactcgtctcaggcgcccataatcgcaacatgttaagaagtttgaaaccaagctcactgtcataagtagtgaag 200  Q
    ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6387893 tggcaaacc-ttgcaaacagagaactgactcgtctcaggcgcc-ataatcgcaacatgttaagaagtttgaaaccaagctcactgtcataagtagtgaag 6387990  T
201 aggagactaataggctcaagtggtgctgttgagcagat 238  Q
    ||||||||||| ||||||||||||||||||||||||||    
6387991 aggagactaatgggctcaagtggtgctgttgagcagat 6388028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126695 times since January 2019
Visitors: 1391