View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk478-10 (Length: 357)

Name: R108-tnk478-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk478-10
R108-tnk478-10
[»] chr7 (4 HSPs)
chr7 (158-357)||(8761824-8762023)
chr7 (158-357)||(8788371-8788570)
chr7 (1-161)||(8762024-8762184)
chr7 (1-161)||(8788571-8788715)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 158 - 357
Target Start/End: Original strand, 8761824 - 8762023
Alignment:
158 aattgtgttgaaatcaacctcattagtgaaagtagagccattatacttctgcacattttccacaacatttccatttaatttatgttgaggaaattgtcta 257  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8761824 aattgtgttgaaatcaacctcattagtgaaagtagaaccattatacttctgcacattttccacaacatttccatttaatttatgttgaggaaattgtcta 8761923  T
258 ttctttgaaacatttccttcattattaactgatcctgctagaaactctcttccactccctcccctaatatcagaaatagaatccagaccaaaccctcctt 357  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8761924 ttctttgaaacatttccttcattattaactgatcctgctagaaactctcttccactccctcccctaatatcagaaatagaatccagaccaaaccctcctt 8762023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 158 - 357
Target Start/End: Original strand, 8788371 - 8788570
Alignment:
158 aattgtgttgaaatcaacctcattagtgaaagtagagccattatacttctgcacattttccacaacatttccatttaatttatgttgaggaaattgtcta 257  Q
    |||| ||||||| |||||||||||||||||||||||  ||||| |||| ||| ||||||||||||||||||||| ||||||||| |||||||||||||||    
8788371 aattttgttgaactcaacctcattagtgaaagtagaatcattaaacttttgctcattttccacaacatttccatctaatttatgctgaggaaattgtcta 8788470  T
258 ttctttgaaacatttccttcattattaactgatcctgctagaaactctcttccactccctcccctaatatcagaaatagaatccagaccaaaccctcctt 357  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||    
8788471 ttctttgaaacatttccttcattattaactgatcctgctggaaactctcttccactccctcccctaatatcaaaaatagaatccagacgaaacactcctt 8788570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 8762024 - 8762184
Alignment:
1 gaaccaaaccaaaattttcatccacaaaagatctacaattcttattttcattttgacccctttcgttgaagcaaaaactattgttatttgcacttaaacc 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||  || |    
8762024 gaaccaaaccaaaattttcattcacaaaagatctacaattcttattttcattttgaccccttttgttgaagaaaaaactattgttatttgcactagaatc 8762123  T
101 ccttaatccattattcatagttccaattccaaccatttctgctacattattcagctgaatt 161  Q
    |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||    
8762124 ccttaatccattattcatagttccaattccaaccatttctgctctattattcagctgaatt 8762184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 8788571 - 8788715
Alignment:
1 gaaccaaaccaaaattttcatccacaaaagatctacaattcttattttcattttgacccctttcgttgaagcaaaaactattgttatttgcacttaaacc 100  Q
    ||||||||||||||||||||| ||||||||||||| ||||| ||||||||||||||| ||||||               |||||||||| |||| | | |    
8788571 gaaccaaaccaaaattttcattcacaaaagatctaaaattcatattttcattttgactcctttc---------------attgttattttcact-agagc 8788654  T
101 ccttaatccattattcatagttccaattccaaccatttctgctacattattcagctgaatt 161  Q
    |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||    
8788655 ccttaatccattgttcatagttccaattccaaccatttctgctccattattcagctgaatt 8788715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 312436 times since January 2019
Visitors: 445