View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk478-3 (Length: 277)

Name: R108-tnk478-3
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk478-3
R108-tnk478-3
[»] chr6 (1 HSPs)
chr6 (4-277)||(17347943-17348216)


Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 4 - 277
Target Start/End: Complemental strand, 17348216 - 17347943
Alignment:
4 ttggttaaggaaattgatttccctgcagagagaaaatttgagcctaggttggtagaatcatcacctatgaaaagcctattgaaaatggtaacattgttat 103  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
17348216 ttggttaaggaaattgatttctctgcagagagaaaatttgagcctaggttggtagaatcatcacctatgaaaagcctattgaaaatggtagcattgttat 17348117  T
104 ttgatccacagttgagaaggtagttatctgtaggagtgaaagaagataatgaaaagggaatgaaaatgagaagaatgaaatgtataatcagattatgagt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||    
17348116 ttgatccacagttgagaaggtagttatctgtaggagtgaaagaagatgatgaaaatggaatgaaaatgagaaaaatgaaatgtataatcagattatgagt 17348017  T
204 gtccatggaagaagaaaaaagctatggtttttgaaactcacatcaagaataagtataaactagaaactgaagtg 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
17348016 gtccatggaagaagaaaaaagctatggtttttgaaactcacatcaagaataagtagaaactagaaactgaagtg 17347943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106246 times since January 2019
Visitors: 1320