View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk478-6 (Length: 533)

Name: R108-tnk478-6
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk478-6
R108-tnk478-6
[»] chr7 (8 HSPs)
chr7 (1-532)||(47300781-47301312)
chr7 (1-532)||(47296189-47296720)
chr7 (79-532)||(47275115-47275568)
chr7 (79-526)||(47264547-47264994)
chr7 (88-531)||(47281862-47282308)
chr7 (88-526)||(47255512-47255950)
chr7 (345-532)||(47240817-47241004)
chr7 (1-212)||(47240604-47240814)
[»] chr5 (2 HSPs)
chr5 (1-532)||(32729139-32729669)
chr5 (375-427)||(15548732-15548783)
[»] chr3 (1 HSPs)
chr3 (103-526)||(20511577-20512000)
[»] scaffold0042 (1 HSPs)
scaffold0042 (357-457)||(91706-91806)
[»] chr1 (3 HSPs)
chr1 (357-427)||(36307164-36307234)
chr1 (357-457)||(14880036-14880136)
chr1 (385-455)||(14789595-14789665)
[»] scaffold0502 (1 HSPs)
scaffold0502 (382-418)||(11532-11568)


Alignment Details
Target: chr7 (Bit Score: 488; Significance: 0; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 488; E-Value: 0
Query Start/End: Original strand, 1 - 532
Target Start/End: Complemental strand, 47301312 - 47300781
Alignment:
1 gcaaacaatgtatagcaacaccctcaaacgaaacgaaccacttatataaaacttctgtcttttttccccttccttctgatatcatgacttcatcaccatt 100  Q
    |||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47301312 gcaatcaatgtatagcaacacacttaaacgaaacgaaccacttatataaaacttctgtcttttttccccttccttctgatatcatgacttcatcaccatt 47301213  T
101 gttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatctgacatagatgatcaagaaggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47301212 gttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatctgacatagatgatcaagaaggt 47301113  T
201 ttgcgtttcaatattcctatgatctttatctatcatcacgaaccatcaatgtcagagaaagaccctgttaaggttcttagacatgcactctcacaagcac 300  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||    
47301112 ttgcgcttcaatattcctatgatctttatctatcatcacgaaccatcaatggcagagaaagaccctgttaaggttctgagacatgcactctcacaagcac 47301013  T
301 ttgtttattactatccatttgcgggaaggattagggagggagctaggcgcaggttgatggtggattgtactggcgagggtgtcatgttcattgaagctga 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||    
47301012 ttgtttattactatccatttgcgggaaggattagggagggagctagtcgcaagttgatggtggattgtactggcgagggtgtcatgttcattgaagctga 47300913  T
401 agctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccatcaactcctatatgatgttccaggctcagaacaaattatg 500  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||    
47300912 agctgatgtaacacttgatcaatttggtgatgccctgcatcctccattcccttgcttccatcaactcctatatgatgttcgaggctcggaacaaattatg 47300813  T
501 gaccgtcccattcgactcatacaggttcaatt 532  Q
    ||||||||||||||||||||||||||||||||    
47300812 gaccgtcccattcgactcatacaggttcaatt 47300781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 532
Target Start/End: Complemental strand, 47296720 - 47296189
Alignment:
1 gcaaacaatgtatagcaacaccctcaaacgaaacgaaccacttatataaaacttctgtcttttttccccttccttctgatatcatgacttcatcaccatt 100  Q
    |||| ||||| |||||||||| | ||||||||||||| || || |||||||||||||||||||||| |||||||| ||||||||||||||||||| | ||    
47296720 gcaatcaatgcatagcaacacacccaaacgaaacgaaacagttgtataaaacttctgtcttttttctccttccttttgatatcatgacttcatcatcgtt 47296621  T
101 gttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatctgacatagatgatcaagaaggt 200  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
47296620 aatgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactcctcgtgaagttaaactattatctgacatagatgatcaagaaggt 47296521  T
201 ttgcgtttcaatattcctatgatctttatctatcatcacgaaccatcaatgtcagagaaagaccctgttaaggttcttagacatgcactctcacaagcac 300  Q
     |||| ||||||| |||| | || ||||||||||  ||| |||||||||||  ||||||||||||| ||||||| ||||||||||||||||||| | |||    
47296520 atgcgattcaatagtcctgtcatatttatctatcgccacaaaccatcaatggtagagaaagaccctcttaaggtgcttagacatgcactctcacgaacac 47296421  T
301 ttgtttattactatccatttgcgggaaggattagggagggagctaggcgcaggttgatggtggattgtactggcgagggtgtcatgttcattgaagctga 400  Q
    |||| |||||||||||| |||||||||| ||||||||||||||| |||||| ||||||||||||||||||||| || |||||||||||||||||||||||    
47296420 ttgtgtattactatccacttgcgggaagaattagggagggagctgggcgcaagttgatggtggattgtactggtgaaggtgtcatgttcattgaagctga 47296321  T
401 agctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccatcaactcctatatgatgttccaggctcagaacaaattatg 500  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||  |||||||||     
47296320 agctgatgtaacacttgatcaatttggtgatgccctgcatcctccattcccttgcttccaacaactcctatatgatgttccaggctcaacacaaattatc 47296221  T
501 gaccgtcccattcgactcatacaggttcaatt 532  Q
    |||||||||||||| |  ||||||||||||||    
47296220 gaccgtcccattcggcaaatacaggttcaatt 47296189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 79 - 532
Target Start/End: Original strand, 47275115 - 47275568
Alignment:
79 atatcatgacttcatcaccattgttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatc 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||    
47275115 atatcatgacttcatcaccattgttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactcctcgcgaagttaaactattatc 47275214  T
179 tgacatagatgatcaagaaggtttgcgtttcaatattcctatgatctttatctatcatcacgaaccatcaatgtcagagaaagaccctgttaaggttctt 278  Q
    ||||||||||||||||||| | |||||||||||||| ||||| || |||||||||| ||| ||||||||||||  |||||||||||||| ||||||||||    
47275215 tgacatagatgatcaagaatgcttgcgtttcaatatgcctatcatatttatctatcgtcatgaaccatcaatgatagagaaagaccctgctaaggttctt 47275314  T
279 agacatgcactctcacaagcacttgtttattactatccatttgcgggaaggattagggagggagctaggcgcaggttgatggtggattgtactggcgagg 378  Q
    | || ||||||||||||| ||||||||||||| |||||| |||||||||| ||||||||||||||||||  || |||||||||||||||||| || ||||    
47275315 aaacgtgcactctcacaaacacttgtttattattatccacttgcgggaagaattagggagggagctagggacaagttgatggtggattgtaccggtgagg 47275414  T
379 gtgtcatgttcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccatcaactcctatatgatgt 478  Q
    | ||||||||||||||||||||| ||||||| ||||||||| ||||||||||||| |||||||| |||||||||||||||||  ||||| |||| |||||    
47275415 gagtcatgttcattgaagctgaaactgatgttacacttgatgaatttggtgatgcactgcatcccccattcccttgcttccaagaactcatatacgatgt 47275514  T
479 tccaggctcagaacaaattatggaccgtcccattcgactcatacaggttcaatt 532  Q
    ||||||| || | |||||||| || | ||||||||  || |||||||| |||||    
47275515 tccaggcacaaaccaaattattgatcatcccattctgcttatacaggtccaatt 47275568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 79 - 526
Target Start/End: Original strand, 47264547 - 47264994
Alignment:
79 atatcatgacttcatcaccattgttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatc 178  Q
    |||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||    
47264547 atatcatgacttcagcaccattattgttcacagtgcggaggagccaaccagagttggtgccaccagctgcacccactcctcgcgaagttaaactattgtc 47264646  T
179 tgacatagatgatcaagaaggtttgcgtttcaatattcctatgatctttatctatcatcacgaaccatcaatgtcagagaaagaccctgttaaggttctt 278  Q
    |||||||||||| |||||||| || |||||||||||||||||||| |||||||||| ||| ||||| ||||||  ||| ||||| |||||||| ||||||    
47264647 tgacatagatgaccaagaaggcttacgtttcaatattcctatgatgtttatctatcgtcatgaaccgtcaatgaaagaaaaagatcctgttaaagttctt 47264746  T
279 agacatgcactctcacaagcacttgtttattactatccatttgcgggaaggattagggagggagctaggcgcaggttgatggtggattgtactggcgagg 378  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| | |||| ||||||||| ||||||||||||||||    
47264747 agacatgcactctcacaagcacttgtttattactatccatttgcaggaaggattagggagggtgctggacgcaagttgatggtcgattgtactggcgagg 47264846  T
379 gtgtcatgttcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccatcaactcctatatgatgt 478  Q
    | || |||||| |||||||||||||||||||||| |||||| |||| ||||| ||| ||||||| ||| |||| |||||| |  |||| ||||| |||||    
47264847 gagttatgttcgttgaagctgaagctgatgtaacccttgatgaattcggtgacgctttgcatcccccactcccatgcttcgaagaacttctatacgatgt 47264946  T
479 tccaggctcagaacaaattatggaccgtcccattcgactcatacaggt 526  Q
    |||||| || |||| |||||| ||||||||||||||||||||||||||    
47264947 tccaggatcggaactaattattgaccgtcccattcgactcatacaggt 47264994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 88 - 531
Target Start/End: Original strand, 47281862 - 47282308
Alignment:
88 cttcatcaccattgttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatctgacataga 187  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||    
47281862 cttcatcaccattattgttgacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactcctcgcgaagttaaactattatctgacataga 47281961  T
188 tgatcaagaaggtttgcgtttcaatattcctatgatctttatctatcatcacgaaccatcaatgtcagagaaagaccctgttaaggttcttagacatgca 287  Q
    |||||||||| |||||||||||||||| ||||| || |||||||||| ||||||||||||||||  | |||||||||||||||||||||||| |  ||||    
47281962 tgatcaagaatgtttgcgtttcaatatgcctatcatatttatctatcgtcacgaaccatcaatggtaaagaaagaccctgttaaggttcttaaatgtgca 47282061  T
288 ctctcacaagcacttgtttattactatccatttgcgggaaggattagggagggagctaggcgcaggttgatggtggattgtac---tggcgagggtgtca 384  Q
    |||||| || |||||||||||||||||||| |||||||||| ||||||||||||||||||  ||  |||||||||||||||||   ||| || |||||||    
47282062 ctctcaaaaacacttgtttattactatccacttgcgggaagaattagggagggagctagggacaaattgatggtggattgtactggtggtgaaggtgtca 47282161  T
385 tgttcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccatcaactcctatatgatgttccagg 484  Q
    |||||||||||||||||||||||||||||||| || |||||||||||||||| ||||| |||||||||||||||||  ||||| |||||||||||||| |    
47282162 tgttcattgaagctgaagctgatgtaacacttaatgaatttggtgatgctcttcatcccccattcccttgcttccaagaactcatatatgatgttccaag 47282261  T
485 ctcagaacaaattatggaccgtcccattcgactcatacaggttcaat 531  Q
    | |  ||||||| || || | ||| ||||  ||||||||||| ||||    
47282262 cacgaaacaaatcattgatcatcctattctgctcatacaggtccaat 47282308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 88 - 526
Target Start/End: Original strand, 47255512 - 47255950
Alignment:
88 cttcatcaccattgttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatctgacataga 187  Q
    ||||||||||||| ||||||||||||||||||| ||||||||||||||| |  ||||||||||||||||||  ||||||||||||  | |||||||| ||    
47255512 cttcatcaccattattgttcacagtgcggaggtcccaaccagagttggtacttccagctgcacccactcctcatgaagttaaactcctctctgacattga 47255611  T
188 tgatcaagaaggtttgcgtttcaatattcctatgatctttatctatcatcacgaaccatcaatgtcagagaaagaccctgttaaggttcttagacatgca 287  Q
    ||||||||||||  | ||||||||| ||||| | || ||| ||| || ||| ||||| ||||||  |||||||||||||||||||||||||| |||||||    
47255612 tgatcaagaaggccttcgtttcaatcttcctgtcatatttgtctttcgtcatgaaccttcaatgaaagagaaagaccctgttaaggttcttaaacatgca 47255711  T
288 ctctcacaagcacttgtttattactatccatttgcgggaaggattagggagggagctaggcgcaggttgatggtggattgtactggcgagggtgtcatgt 387  Q
    ||||||| | ||||||||||||||||||||  ||| ||||||||||||||||| ||| |||||| ||||||||||||||| || || |||||||||||||    
47255712 ctctcacgaacacttgtttattactatccaggtgcaggaaggattagggagggtgctgggcgcaagttgatggtggattgcaccggggagggtgtcatgt 47255811  T
388 tcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccatcaactcctatatgatgttccaggctc 487  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||  || | |||| |||||||||||||||    
47255812 tcattgaagctgaagctgatataacacttgatcaatttggtgatgctctgcaacctccatttccttgcttccaagaaattctatgtgatgttccaggctc 47255911  T
488 agaacaaattatggaccgtcccattcgactcatacaggt 526  Q
    |||| | ||||| ||||||||||| ||||| ||||||||    
47255912 agaatatattattgaccgtcccatccgacttatacaggt 47255950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 345 - 532
Target Start/End: Original strand, 47240817 - 47241004
Alignment:
345 aggcgcaggttgatggtggattgtactggcgagggtgtcatgttcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctc 444  Q
    ||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47240817 aggcgcaagttgatggtggattgtactggtgaaggtgtcatgttcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctc 47240916  T
445 cattcccttgcttccatcaactcctatatgatgttccaggctcagaacaaattatggaccgtcccattcgactcatacaggttcaatt 532  Q
    |||||||||||||||| |||||| |||| |||||||||||||||||||| ||||| |||||| ||||| ||||||||||||| |||||    
47240917 cattcccttgcttccaacaactcttatacgatgttccaggctcagaacatattattgaccgtaccatttgactcatacaggtccaatt 47241004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 47240604 - 47240814
Alignment:
1 gcaaacaatgtatagcaacaccctcaaacgaaacgaaccacttatataaaacttctgtcttttttccccttccttctgatatcatgacttcatcaccatt 100  Q
    |||| |||| |||| |||||| ||||||||||||||| |  ||||||||||||| |  ||||||| ||||||||| | ||||||||||||||||| | ||    
47240604 gcaatcaatatataacaacacactcaaacgaaacgaaaccgttatataaaacttgtc-ctttttttcccttccttttaatatcatgacttcatcatcgtt 47240702  T
101 gttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatctgacatagatgatcaagaaggt 200  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||    
47240703 aatgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactcctcgcgaagttaaactattatctgacatagatgatcaagaaggt 47240802  T
201 ttgcgtttcaat 212  Q
    ||||| ||||||    
47240803 ttgcgattcaat 47240814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 356; Significance: 0; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 532
Target Start/End: Original strand, 32729139 - 32729669
Alignment:
1 gcaaacaatgtatagcaacaccctcaaacgaaacgaaccacttatataaaacttctgtcttttttccccttccttctgatatcatgacttcatcaccatt 100  Q
    |||| |||| |||| |||||| |||||| ||||||||    |||||| |||||| |  ||||||| || |||||| | ||||||||||||||||||||||    
32729139 gcaatcaatatataacaacacactcaaaggaaacgaaatcgttatattaaacttgtc-ctttttttcctttccttttaatatcatgacttcatcaccatt 32729237  T
101 gttgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatctgacatagatgatcaagaaggt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||| ||||||||||||||||||    
32729238 gttgttcacagtgcggaggtgccaaccagagttggtgccaccagttgcacccactcctcgcgaagttaaactattatctgatatagatgatcaagaaggt 32729337  T
201 ttgcgtttcaatattcctatgatctttatctatcatcacgaaccatcaatgtcagagaaagaccctgttaaggttcttagacatgcactctcacaagcac 300  Q
    |||||||||||| ||||| | || |||||||||| || ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| | |||    
32729338 ttgcgtttcaatgttcctgtcatatttatctatcgtcgcgaaccatcaatggcagagaaagaccctattaaggttcttagacatgcactctcacgaacac 32729437  T
301 ttgtttattactatccatttgcgggaaggattagggagggagctaggcgcaggttgatggtggattgtactggcgagggtgtcatgttcattgaagctga 400  Q
    |||| |||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||    
32729438 ttgtgtattactacccatttgcgggaaggattagggagggtgctaggcgcaagttgatggtggattgtactggtgagggtgtcgtgttcattgaagctga 32729537  T
401 agctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccatcaactcctatatgatgttccaggctcagaacaaattatg 500  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||| |||||     
32729538 agctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccaacaactcttatacgatgttccaggctcagaacatattatt 32729637  T
501 gaccgtcccattcgactcatacaggttcaatt 532  Q
    |||||||||||||||||||||||||| |||||    
32729638 gaccgtcccattcgactcatacaggtccaatt 32729669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 375 - 427
Target Start/End: Complemental strand, 15548783 - 15548732
Alignment:
375 gagggtgtcatgttcattgaagctgaagctgatgtaacacttgatcaatttgg 427  Q
    |||||||| ||||||||||| ||||| ||| ||||||||||||| ||||||||    
15548783 gagggtgtgatgttcattgaggctgatgct-atgtaacacttgaacaatttgg 15548732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 103 - 526
Target Start/End: Original strand, 20511577 - 20512000
Alignment:
103 tgttcacagtgcggaggtgccaaccagagttggtgccaccagctgcacccactccttgtgaagttaaactattatctgacatagatgatcaagaaggttt 202  Q
    ||||||| ||||| |||||||||||| || |||| || |||||||||||||||||| ||||| ||||| || |||||||||||||||||||| || || |    
20511577 tgttcactgtgcgaaggtgccaaccacagctggtacctccagctgcacccactcctcgtgaatttaaaatactatctgacatagatgatcaaaaaagtct 20511676  T
203 gcgtttcaatattcctatgatctttatctatcatcacgaaccatcaatgtcagagaaagaccctgttaaggttcttagacatgcactctcacaagcactt 302  Q
     |||| |||||||| | | ||||||||||||||||| ||||||| |||| || |||||||||||||||||||||||||||||||||||||||||| ||||    
20511677 ccgttgcaatattcttctcatctttatctatcatcatgaaccattaatgacaaagaaagaccctgttaaggttcttagacatgcactctcacaagtactt 20511776  T
303 gtttattactatccatttgcgggaaggattagggagggagctaggcgcaggttgatggtggattgtactggcgagggtgtcatgttcattgaagctgaag 402  Q
    ||  ||||||||||||||||||||||||||||||| |||| | | |  | ||| ||||||||||||||||| ||||||||||||||||||||||||||||    
20511777 gtgcattactatccatttgcgggaaggattagggaaggagttggacaaaagttaatggtggattgtactggtgagggtgtcatgttcattgaagctgaag 20511876  T
403 ctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgcttccatcaactcctatatgatgttccaggctcagaacaaattatgga 502  Q
    || |||||||||||||| | |||||||| | | ||||||| |||||||| ||| || || |||| ||||| ||||||||||  || | || || ||| ||    
20511877 ctaatgtaacacttgatgactttggtgacggtttgcatcccccattcccatgcgtcgatgaacttctatacgatgttccagattcggtactaaatattga 20511976  T
503 ccgtcccattcgactcatacaggt 526  Q
     |||||||||||||| ||||||||    
20511977 tcgtcccattcgacttatacaggt 20512000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0042 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: scaffold0042
Description:

Target: scaffold0042; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 357 - 457
Target Start/End: Complemental strand, 91806 - 91706
Alignment:
357 atggtggattgtactggcgagggtgtcatgttcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgct 456  Q
    ||||| ||||||||||| || |||||  |||| ||||||||||| |||||||| || ||| | |||||||||||||| || ||||||||||| || ||||    
91806 atggttgattgtactggagaaggtgttttgtttattgaagctgatgctgatgttactcttaaacaatttggtgatgcacttcatcctccatttccatgct 91707  T
457 t 457  Q
    |    
91706 t 91706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 357 - 427
Target Start/End: Original strand, 36307164 - 36307234
Alignment:
357 atggtggattgtactggcgagggtgtcatgttcattgaagctgaagctgatgtaacacttgatcaatttgg 427  Q
    ||||||||||||| ||| || ||||| ||||||||||| || || ||||||||||||||||| ||||||||    
36307164 atggtggattgtaatggagaaggtgttatgttcattgaggcagatgctgatgtaacacttgaacaatttgg 36307234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 357 - 457
Target Start/End: Complemental strand, 14880136 - 14880036
Alignment:
357 atggtggattgtactggcgagggtgtcatgttcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgct 456  Q
    ||||||||||| ||||| || |||||  |||| ||||||||||| || ||||| || ||| |  | |||||||||||||| ||||||||||| |||||||    
14880136 atggtggattgcactggagaaggtgttttgtttattgaagctgatgcagatgttactcttaaagagtttggtgatgctcttcatcctccatttccttgct 14880037  T
457 t 457  Q
    |    
14880036 t 14880036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 455
Target Start/End: Complemental strand, 14789665 - 14789595
Alignment:
385 tgttcattgaagctgaagctgatgtaacacttgatcaatttggtgatgctctgcatcctccattcccttgc 455  Q
    |||| ||||||||||| |||||||| || ||||| ||||||||||| | ||| ||||||||||| ||||||    
14789665 tgtttattgaagctgatgctgatgttactcttgaacaatttggtgaagatcttcatcctccatttccttgc 14789595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0502 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0502
Description:

Target: scaffold0502; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 382 - 418
Target Start/End: Complemental strand, 11568 - 11532
Alignment:
382 tcatgttcattgaagctgaagctgatgtaacacttga 418  Q
    ||||||||||||||||||| || ||||||||||||||    
11568 tcatgttcattgaagctgatgcagatgtaacacttga 11532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110868 times since January 2019
Visitors: 1335