View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk48-1 (Length: 673)

Name: R108-tnk48-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk48-1
R108-tnk48-1
[»] chr8 (3 HSPs)
chr8 (104-588)||(25116309-25116779)
chr8 (1-105)||(25116179-25116283)
chr8 (596-673)||(25116106-25116183)


Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 104 - 588
Target Start/End: Original strand, 25116309 - 25116779
Alignment:
104 ataagaaaggtgatcgcgacctcattgtcgaacatcctgatccagaaattgacaaaggttcgatgagtgcaaatgagaagcgtgacgnnnnnnnggagtg 203  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||    
25116309 ataagaaaggtaatcgcgacctcattgtcgaacatcctgatccagaaattgacaaaggttcgatgagtgcaaatgagaagcgtgacgaaaaaaaggagtg 25116408  T
204 tcatacaggtgaaggttacatgattattatagtgaactcatttaagtacgatttgtttattactttaaaacatggccatttccagttatgtccgaagtga 303  Q
    |||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||| ||  | |||| ||||||||||   |||||    
25116409 tcatacaggtgaaggttacatgatcattatagtgaactcatttacgttcgatttgtttattactttaaaatatttc-attttcagttatgtcg--agtga 25116505  T
304 aagccgtttttcttaccctgaacaaaggtcccagaagagggttaggaatactcgaaggatttacccaaaaatttgagaaggtcccctacatagctacaga 403  Q
    |   |||||| |||||| ||||||||| || |||| |||| |||||||||||||| |||||   ||||||||||||||||   |||||||||||||||||    
25116506 ag--cgtttt-cttacc-tgaacaaag-tcacaga-gagg-ttaggaatactcga-ggatta--ccaaaaatttgagaagt--ccctacatagctacaga 25116593  T
404 atgggaacaattacaagagaagaactacaaacaatggtaatgttgtttatacatccaaattttcagaagttacatttttggattttctgtcacatcctat 503  Q
    ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
25116594 atgggaacaattacaagagaagaactacaaaaaatggtaatattgtttatacatccaaattttcagaagttacattttttgattttctgtcacatcctat 25116693  T
504 aactcttgaattgaatatggcttgcattgaacattaaactttaatacaaaaattatgtt-aaaatactgaaacggagaagaattca 588  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||    
25116694 aactcttgaattgaatatggcttgcattgaacattaaactttaatacaaaaattatgttaaaaatactgtaacggagaagaattca 25116779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 25116179 - 25116283
Alignment:
1 ctgagtaccgagaaggccaacgatttgcaaggtgatcatgatctcattgccaaaaatcttgatccagaatttaacaaaggtttgataagtgcagaggtgt 100  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
25116179 ctgagtaccgagaaggccaaagatttgcaaggtgatcatgatctcattgccaaaaatcttgatccagaatttaacaaaggtttgatgagtgcagaggtgt 25116278  T
101 ctgat 105  Q
    |||||    
25116279 ctgat 25116283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 596 - 673
Target Start/End: Original strand, 25116106 - 25116183
Alignment:
596 tgataatggtgtttgaatttcttgaaattgataatcttttaaatgccttttcattaggaatttgtttgtcggactgag 673  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||    
25116106 tgataatggtgtttgaatttcttgaaattgataatcttttaaatgctttttcattaggaatttgtttgtcgaactgag 25116183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110787 times since January 2019
Visitors: 1335