View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk48-10 (Length: 1622)

Name: R108-tnk48-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk48-10
R108-tnk48-10
[»] chr1 (4 HSPs)
chr1 (76-1622)||(50980242-50981782)
chr1 (1260-1488)||(50964923-50965152)
chr1 (1-83)||(50980164-50980246)
chr1 (87-296)||(50965377-50965587)
[»] chr4 (9 HSPs)
chr4 (929-1144)||(13640233-13640448)
chr4 (1273-1472)||(13641257-13641456)
chr4 (563-791)||(13638687-13638915)
chr4 (239-423)||(13637831-13638012)
chr4 (1151-1261)||(13640665-13640775)
chr4 (794-930)||(13639066-13639202)
chr4 (109-242)||(13636559-13636692)
chr4 (445-561)||(13638142-13638256)
chr4 (1476-1546)||(13715355-13715424)
[»] scaffold0188 (8 HSPs)
scaffold0188 (929-1147)||(10983-11201)
scaffold0188 (563-791)||(10009-10237)
scaffold0188 (801-930)||(10397-10526)
scaffold0188 (1281-1454)||(11644-11817)
scaffold0188 (239-422)||(9003-9183)
scaffold0188 (445-561)||(9292-9406)
scaffold0188 (1151-1250)||(11288-11387)
scaffold0188 (91-242)||(8213-8364)
[»] chr8 (1 HSPs)
chr8 (833-930)||(10478798-10478895)
[»] chr5 (1 HSPs)
chr5 (1458-1550)||(33632608-33632699)


Alignment Details
Target: chr1 (Bit Score: 1456; Significance: 0; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 1456; E-Value: 0
Query Start/End: Original strand, 76 - 1622
Target Start/End: Complemental strand, 50981782 - 50980242
Alignment:
76 tcaattgctagttttttattaccactagctttagttttgaatttagtgtcggtgtgtaatggaggcacaaccagtgcttttgttaggaatgttcagaaag 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
50981782 tcaattgctagttttttattaccactagctttagttttgaatttagtgtctgtgtgtaatggaggcacaaccagtgcttttgttaggaatgttcagaaag 50981683  T
176 gcgttaatatgtcacttgatagtgatgtttttgctgttccttctggttataatgctccccaacaggttcatattacacaaggtgatcttgttgggaaaga 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50981682 gcgttaatatgtcacttgatagtgatgtttttgctgttccttctggttataatgctccccaacaggttcatattacacaaggtgatcttgttgggaaaga 50981583  T
276 agtgatcgtatcgtgggtgaccgaggatgaaccagggtcgatcgcagtgcgctactggagtactgacaacagcaaacaaaagaagatagctaaagggaaa 375  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
50981582 agtgatcgtatcgtgggtgaccgaggatgaaccagggtcgatcgcagtgcgctactggagtactgacaacagcaaacaaaagaagctagctaaagggaaa 50981483  T
376 attggtacctatagattcttcaattactcatctgggtttattcatcaccacctactataaggaatttggagtacaacactaaatattattatgaggttgg 475  Q
    |||| ||| |||||||||||||||||||||||||| ||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||    
50981482 attgttacttatagattcttcaattactcatctggttttattcatcaca--ctactataaggaatttggagtacaacactaaatattattatgaggttgg 50981385  T
476 acttgggaaccaccaacaagacagttttggtttataactcctcctgaaattggtcctgatgtgccatacacatttggtctcataggagatctcggtcaga 575  Q
    ||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50981384 acttgggaaca--caacaagacagttttggtttataactcctcctgaaattggtcctgatgtgccatacacatttggtctcataggagatctcggtcaga 50981287  T
576 gctttgattcaaacagaacactttctcactatgaattgaatcctagaaaggggcaaacagtgttgtttgttggagatctctcttattcagataactttcc 675  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50981286 gctttgattcaaacagaacactttctcactatgaattgaatcctagaaaggggcaaacagtgttgtttgttggagatctctcttattcagataactttcc 50981187  T
676 aaatcatgacaatgttaggtgggatacttggggaaggtttgtagaaaggagcacggcttatcagccgtggatatggactgtaggaaaccatgaaattgat 775  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50981186 aaatcatgacaatgttaggtgggatacttggggaaggtttgtagaaaggagcacggcttatcagccgtggatatggactgtaggaaaccatgaaattgat 50981087  T
776 tttgccccagaaattggcgaaaccaaaccattcaaaccttattcgcaccgataccacactccttataaagcatcacaaagtacttcacccttttggtatt 875  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50981086 tttgccccagaaattggcgaaaccaaaccattcaaaccttattcgcaccgataccacactccttataaagcatcacaaagtacttcacccttttggtatt 50980987  T
876 ctatcagaagagcttcagctcacatcattgtcttggcctcgtattcagcatatggaaaatatacaccacagtaccaatggcttgaacaagagctacctaa 975  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
50980986 ctatcagaagagcttcagctcacatcattgtcttggcctcgtattcaggatatggaaaatatacaccacagtaccaatggcttgaacaagagctacctaa 50980887  T
976 agttaacaggacagaaactccttggttgattgttctaatgcattcaccttggtataatagcaacaatcaacattatatggaaggggagacaatgagagta 1075  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50980886 agttaacaggacagaaactccttggttgattgttctaatgcattcaccttggtataatagcaacaatcaacattatatggaaggggagacaatgagagta 50980787  T
1076 atgtatgagccatggtttgttaagtacaaggttgatgttgtgtatgctggacatgtgcatgcctatgaaagaaccgaacgtgtgtcgaatattgcatata 1175  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50980786 atgtatgagccatggtttgttaagtacaaggttgatgttgtgtatgctggacatgtgcatgcctatgaaagaaccgaacgtgtgtcgaatattgcatata 50980687  T
1176 atgttgtgaatggtatttgcactcctataaaagatcaatcagctcctgtatacatacccattggagatggagggacccttggaggcatggaaaccaacat 1275  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
50980686 atgttgtgaatggtatttgcactcctataaaagatcaatcagctcctgtatacataaccattggagatggagggaaccttggaggcatggaaaccaacat 50980587  T
1276 gacagaaccacagccagagtactcagcattcagagaggctagctttggacatgccattttcgacataaagaacagaacacatgctcactatagctggcac 1375  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50980586 gacagaaccacagccagagtactcagcattcagagaggctagctttggacatgccattttcgacataaagaacagaacacatgctcactatagctggcac 50980487  T
1376 agaaatcaagatggttattcggttgaggctgattcccattggtttttcaacagattttggcaaccagttgatgattccaccgctcatgttttccattgat 1475  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
50980486 agaaatcaagatggttattcggttgaggctgattcccattggtttttcaacagattttggcatccagttgatgattccaccgctcatgttttccattgat 50980387  T
1476 acattgatttactgctcttttcacaagaatactcaatgtgatgttaatcaataaagncatgattatgtaataattgcttgtagggtcaatcaattatgat 1575  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||    
50980386 acattgatttactgctcttttcacaagaatactcaatgtgatgttaatcaataaagtcatgattatgtaataattgcttgta-ggtcaatcaattatgat 50980288  T
1576 tatcattacacttncgtnctactttgtatgactgttaaatagatgta 1622  Q
    ||||||||| ||| ||| |||||||||||||||||||||||||||||    
50980287 tatcattac-ctttcgttctactttgtatgactgttaaatagatgta 50980242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 142; E-Value: 9e-74
Query Start/End: Original strand, 1260 - 1488
Target Start/End: Complemental strand, 50965152 - 50964923
Alignment:
1260 gcatggaaaccaacatgacagaaccacagccagagtac-tcagcattcagagaggctagctttggacatgccattttcgacataaagaacagaacacatg 1358  Q
    |||| |||||||||||| ||||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50965152 gcatagaaaccaacatgtcagaaccacaggcagagtacattagcattcagagaggctagctttggacatgccattttcgacataaagaacagaacacatg 50965053  T
1359 ctcactatagctggcacagaaatcaagatggttattcggttgaggctgattcccattggtttttcaacagattttggcaaccagttgatgattccaccgc 1458  Q
    ||||||||| ||  |||||||||||| |||||||||| | ||||| ||||||| |||||||||| |||||||||||||| |||||||||||||||||  |    
50965052 ctcactataactatcacagaaatcaaaatggttattctgatgaggttgattccaattggttttttaacagattttggcacccagttgatgattccacatc 50964953  T
1459 tcatgttttccattgatacattgatttact 1488  Q
    |||||||| || || | |||||||||||||    
50964952 tcatgtttccctttaacacattgatttact 50964923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 76; E-Value: 2e-34
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 50980246 - 50980164
Alignment:
1 atgtaaaggagcaagcatcttgttttatgtgtaaaaataaatattacaaaactttaacaagncttctcagctagctcaattgc 83  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||    
50980246 atgtaaaggagcaagcatcttgttttatgtgtaaaaataaatattacaaaactttaacaagacttctcagctagatcaattgc 50980164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 70; E-Value: 8e-31
Query Start/End: Original strand, 87 - 296
Target Start/End: Complemental strand, 50965587 - 50965377
Alignment:
87 ttttttattaccacta---gctttagttttgaatttagtgtcggtgtgtaatggaggcacaaccagtgcttttgttaggaatgttcagaaaggcgttaat 183  Q
    ||||||||||||||||   ||||| ||||||||||| ||||  ||||| |||||||| | ||| ||| |||||||||| || ||  | || |||||||||    
50965587 ttttttattaccactactagctttggttttgaatttggtgtttgtgtgcaatggagggataactagtacttttgttagaaaagtcgaaaagggcgttaat 50965488  T
184 atgtcacttgatagtgatgtttttgctgttcc-ttctggttataatgctccccaacaggttcatattacacaaggtgatcttgttgggaaagaagtgatc 282  Q
    ||||| |||||||| ||||| |||  |||||| |||||||||||| ||||||| | |||||||||| ||   ||||||||||||||||||||  ||||||    
50965487 atgtctcttgatagcgatgtgtttattgttccattctggttataaggctccccgataggttcatataac---aggtgatcttgttgggaaagccgtgatc 50965391  T
283 gtatcgtgggtgac 296  Q
    |||||||| |||||    
50965390 gtatcgtgtgtgac 50965377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 156; Significance: 4e-82; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-82
Query Start/End: Original strand, 929 - 1144
Target Start/End: Original strand, 13640233 - 13640448
Alignment:
929 ggaaaatatacaccacagtaccaatggcttgaacaagagctacctaaagttaacaggacagaaactccttggttgattgttctaatgcattcaccttggt 1028  Q
    ||||||||||||||||| ||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
13640233 ggaaaatatacaccacaatacaaatggcttgaacaggagctaccaaaagttaacaggacagaaactccttggttgattgttctcatgcattcaccttggt 13640332  T
1029 ataatagcaacaatcaacattatatggaaggggagacaatgagagtaatgtatgagccatggtttgttaagtacaaggttgatgttgtgtatgctggaca 1128  Q
    |||||||| ||||| | ||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||    
13640333 ataatagctacaattatcattacatggaaggggaatcaatgagagtaatgtatgagccatggtttgttaagtacaaggttgatgtcgtgtatgctggcca 13640432  T
1129 tgtgcatgcctatgaa 1144  Q
    ||| || |||||||||    
13640433 tgtccacgcctatgaa 13640448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 140; E-Value: 1e-72
Query Start/End: Original strand, 1273 - 1472
Target Start/End: Original strand, 13641257 - 13641456
Alignment:
1273 catgacagaaccacagccagagtactcagcattcagagaggctagctttggacatgccattttcgacataaagaacagaacacatgctcactatagctgg 1372  Q
    ||||||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||    
13641257 catgacagaaccacaaccagagtactcagcatacagagaggccagctttggacatgccatttttgacataaagaacagaacacatgctcactacagctgg 13641356  T
1373 cacagaaatcaagatggttattcggttgaggctgattcccattggtttttcaacagattttggcaaccagttgatgattccaccgctcatgttttccatt 1472  Q
    || || |||||||||||||| || |||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||  ||||||||| |||||    
13641357 cataggaatcaagatggttactctgttgaggctgattctcattggttcttcaacagattttggcacccagttgatgattccacaactcatgtttcccatt 13641456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 133; E-Value: 2e-68
Query Start/End: Original strand, 563 - 791
Target Start/End: Original strand, 13638687 - 13638915
Alignment:
563 gatctcggtcagagctttgattcaaacagaacactttctcactatgaattgaatcctagaaaggggcaaacagtgttgtttgttggagatctctcttatt 662  Q
    ||||| |||||||||| |||||||||||  |||||||||||||| |||||||| || | ||| || ||||||||||||||||||||||||||||| |||     
13638687 gatcttggtcagagctatgattcaaacaagacactttctcactacgaattgaacccaacaaaaggacaaacagtgttgtttgttggagatctctcatatg 13638786  T
663 cagataactttccaaatcatgacaatgttaggtgggatacttggggaaggtttgtagaaaggagcacggcttatcagccgtggatatggactgtaggaaa 762  Q
    |||||||||  || ||||||||||||||||||||||||||||||||||| |||| ||||||||||   |||||||| ||||||||||||||||| |||||    
13638787 cagataactacccgaatcatgacaatgttaggtgggatacttggggaagatttgcagaaaggagcgttgcttatcaaccgtggatatggactgttggaaa 13638886  T
763 ccatgaaattgattttgccccagaaattg 791  Q
    ||||||| |||||||||| ||||||||||    
13638887 ccatgaacttgattttgctccagaaattg 13638915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 91; E-Value: 2e-43
Query Start/End: Original strand, 239 - 423
Target Start/End: Original strand, 13637831 - 13638012
Alignment:
239 aggttcatattacacaaggtgatcttgttgggaaagaagtgatcgtatcgtgggtgaccgaggatgaaccagggtcgatcgcagtgcgctactggagtac 338  Q
    |||||||||| ||||||||||||| ||| ||||||| ||||||||||||||||||||| |||||||||||||| |||| ||||||||| ||||||||||     
13637831 aggttcatataacacaaggtgatcatgtggggaaagcagtgatcgtatcgtgggtgactgaggatgaaccaggctcgaacgcagtgcgttactggagta- 13637929  T
339 tgacaacagcaaacaaaagaagatagctaaagggaaaattggtacctatagattcttcaattactcatctgggtttattcatcac 423  Q
      | |||||||| || |||| | |||||||||||||||||| ||| |||||||| ||||||||| | ||||| ||||| ||||||    
13637930 --agaacagcaagcagaagaggctagctaaagggaaaattgttacttatagatttttcaattacacttctggttttatccatcac 13638012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 87; E-Value: 6e-41
Query Start/End: Original strand, 1151 - 1261
Target Start/End: Original strand, 13640665 - 13640775
Alignment:
1151 gaacgtgtgtcgaatattgcatataatgttgtgaatggtatttgcactcctataaaagatcaatcagctcctgtatacatacccattggagatggaggga 1250  Q
    ||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
13640665 gaacgtgtgtccaatgttgcatataatgttgtaaatggtatttgcactcctataaaagatcaatcagctcctgtatacataaccattggagatggaggga 13640764  T
1251 cccttggaggc 1261  Q
     ||||| ||||    
13640765 accttgaaggc 13640775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 81; E-Value: 2e-37
Query Start/End: Original strand, 794 - 930
Target Start/End: Original strand, 13639066 - 13639202
Alignment:
794 gaaaccaaaccattcaaaccttattcgcaccgataccacactccttataaagcatcacaaagtacttcacccttttggtattctatcagaagagcttcag 893  Q
    ||||| ||||||||||| ||||| |||||||||||||  |||||||| |||||||| |||||||| || |||||||||||||||||||  ||||||||||    
13639066 gaaacaaaaccattcaagccttactcgcaccgataccgtactccttacaaagcatcgcaaagtacctcgcccttttggtattctatcaagagagcttcag 13639165  T
894 ctcacatcattgtcttggcctcgtattcagcatatgg 930  Q
    ||||||||||||| ||||| || ||||||||||||||    
13639166 ctcacatcattgtgttggcttcatattcagcatatgg 13639202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 74; E-Value: 3e-33
Query Start/End: Original strand, 109 - 242
Target Start/End: Original strand, 13636559 - 13636692
Alignment:
109 gttttgaatttagtgtcggtgtgtaatggaggcacaaccagtgcttttgttaggaatgttcagaaaggcgttaatatgtcacttgatagtgatgtttttg 208  Q
    ||||||||||| ||||  |||||||||||||||| ||| ||| ||||||||||||| ||| ||||   | || ||||| |||||||||||||||||||||    
13636559 gttttgaatttggtgtttgtgtgtaatggaggcagaactagtacttttgttaggaaagttgagaagaccattgatatgccacttgatagtgatgtttttg 13636658  T
209 ctgttccttctggttataatgctccccaacaggt 242  Q
     |||||||||||||||||||||||||||||||||    
13636659 atgttccttctggttataatgctccccaacaggt 13636692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 70; E-Value: 8e-31
Query Start/End: Original strand, 445 - 561
Target Start/End: Original strand, 13638142 - 13638256
Alignment:
445 agtacaacactaaatattattatgaggttggacttgggaaccaccaacaagacagttttggtttataactcctcctgaaattggtcctgatgtgccatac 544  Q
    ||||||| || ||||||||||| ||||||||||| ||||||   ||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||    
13638142 agtacaataccaaatattattacgaggttggactcgggaaca--caacaaggcagttttggtttacaactcctcctgaaatcggtcctgatgtgccatac 13638239  T
545 acatttggtctcatagg 561  Q
    ||||||||||| |||||    
13638240 acatttggtctaatagg 13638256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.0000000002
Query Start/End: Original strand, 1476 - 1546
Target Start/End: Original strand, 13715355 - 13715424
Alignment:
1476 acattgatttactgctcttttcacaagaatactcaatgtgatgttaatcaataaagncatgattatgtaat 1546  Q
    |||||||||||| | |||||||| || |||||||| |||||||||||||||||| | ||||||| ||||||    
13715355 acattgatttaccgttcttttcagaa-aatactcattgtgatgttaatcaataatgtcatgattttgtaat 13715424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188 (Bit Score: 131; Significance: 3e-67; HSPs: 8)
Name: scaffold0188
Description:

Target: scaffold0188; HSP #1
Raw Score: 131; E-Value: 3e-67
Query Start/End: Original strand, 929 - 1147
Target Start/End: Original strand, 10983 - 11201
Alignment:
929 ggaaaatatacaccacagtaccaatggcttgaacaagagctacctaaagttaacaggacagaaactccttggttgattgttctaatgcattcaccttggt 1028  Q
    ||||||||||||||||| |||   ||||||||| |||||||||| | ||||||||||| | ||||||| |||||||||||||| ||||||||||||||||    
10983 ggaaaatatacaccacaatacgcgtggcttgaagaagagctaccgagagttaacaggaaaaaaactccgtggttgattgttctcatgcattcaccttggt 11082  T
1029 ataatagcaacaatcaacattatatggaaggggagacaatgagagtaatgtatgagccatggtttgttaagtacaaggttgatgttgtgtatgctggaca 1128  Q
    ||||||||||||   | ||||| ||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||| ||    
11083 ataatagcaacagctatcattacatggaaggggaaacaatgagagtaatgtttgagtcatggtttgttaagtacaaggttgatgttgtgtttgctggcca 11182  T
1129 tgtgcatgcctatgaaaga 1147  Q
    ||| |||||||||||||||    
11183 tgtacatgcctatgaaaga 11201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188; HSP #2
Raw Score: 113; E-Value: 2e-56
Query Start/End: Original strand, 563 - 791
Target Start/End: Original strand, 10009 - 10237
Alignment:
563 gatctcggtcagagctttgattcaaacagaacactttctcactatgaattgaatcctagaaaggggcaaacagtgttgtttgttggagatctctcttatt 662  Q
    ||||| |||||||  |||||||||||||| ||||||||||||||| ||| |||  | | ||| || ||||| ||  ||||||||||||||||||| |||     
10009 gatcttggtcagacttttgattcaaacaggacactttctcactatcaatcgaactcaacaaaaggacaaaccgttctgtttgttggagatctctcatatg 10108  T
663 cagataactttccaaatcatgacaatgttaggtgggatacttggggaaggtttgtagaaaggagcacggcttatcagccgtggatatggactgtaggaaa 762  Q
    |||||||||  || ||||||||||||||||||||||||||||||||||| |||| ||||||||||   |||||||| ||||||||||||||||| |||||    
10109 cagataactacccgaatcatgacaatgttaggtgggatacttggggaagatttgcagaaaggagcgttgcttatcaaccgtggatatggactgttggaaa 10208  T
763 ccatgaaattgattttgccccagaaattg 791  Q
    ||||||| |||||||||| ||||||||||    
10209 ccatgaacttgattttgctccagaaattg 10237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188; HSP #3
Raw Score: 98; E-Value: 2e-47
Query Start/End: Original strand, 801 - 930
Target Start/End: Original strand, 10397 - 10526
Alignment:
801 aaccattcaaaccttattcgcaccgataccacactccttataaagcatcacaaagtacttcacccttttggtattctatcagaagagcttcagctcacat 900  Q
    |||||||||| |||| ||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||    
10397 aaccattcaagcctttttcgcaccgataccaaacgccgtataaagcatcacaaagtacttcacccttttggtattctatcaaaagagcttcagcacatat 10496  T
901 cattgtcttggcctcgtattcagcatatgg 930  Q
    ||||||||||||||||||||||||||||||    
10497 cattgtcttggcctcgtattcagcatatgg 10526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188; HSP #4
Raw Score: 90; E-Value: 9e-43
Query Start/End: Original strand, 1281 - 1454
Target Start/End: Original strand, 11644 - 11817
Alignment:
1281 aaccacagccagagtactcagcattcagagaggctagctttggacatgccattttcgacataaagaacagaacacatgctcactatagctggcacagaaa 1380  Q
    |||||||||| |||||||| ||||| ||||| || |||||||||||||| ||||| ||||||||||| || ||||||||| ||||||||||||| |||||    
11644 aaccacagccggagtactcggcatttagagaagccagctttggacatgcaatttttgacataaagaataggacacatgcttactatagctggcatagaaa 11743  T
1381 tcaagatggttattcggttgaggctgattcccattggtttttcaacagattttggcaaccagttgatgattcca 1454  Q
    |||||||||| || | ||| ||  |||||||| |||||||||||||||||||||| | || |||||||||||||    
11744 tcaagatggtgatgctgttaagagtgattccctttggtttttcaacagattttggaacccggttgatgattcca 11817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188; HSP #5
Raw Score: 82; E-Value: 5e-38
Query Start/End: Original strand, 239 - 422
Target Start/End: Original strand, 9003 - 9183
Alignment:
239 aggttcatattacacaaggtgatcttgttgggaaagaagtgatcgtatcgtgggtgaccgaggatgaaccagggtcgatcgcagtgcgctactggagtac 338  Q
    |||||||||| |||||||| |||| ||| ||||||| ||||||||||||||||||||| ||||||||||| ||||||   |||||||| ||||||||       
9003 aggttcatataacacaaggcgatcatgtggggaaagcagtgatcgtatcgtgggtgactgaggatgaacccgggtcggatgcagtgcgttactggag--- 9099  T
339 tgacaacagcaaacaaaagaagatagctaaagggaaaattggtacctatagattcttcaattactcatctgggtttattcatca 422  Q
    ||| |||||||| || |||||| | |||||||| |||||||  || ||||||| |||||||||||||||||| |||||||||||    
9100 tgagaacagcaagcacaagaagcttgctaaaggaaaaattgaaacttatagatacttcaattactcatctggttttattcatca 9183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188; HSP #6
Raw Score: 78; E-Value: 1e-35
Query Start/End: Original strand, 445 - 561
Target Start/End: Original strand, 9292 - 9406
Alignment:
445 agtacaacactaaatattattatgaggttggacttgggaaccaccaacaagacagttttggtttataactcctcctgaaattggtcctgatgtgccatac 544  Q
    ||||||| || |||||||||||||||||||||||| |||||   ||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||    
9292 agtacaataccaaatattattatgaggttggacttaggaaca--caacaaggcagttttggtttacaactcctcctgcaattggtcctgatgtgccatac 9389  T
545 acatttggtctcatagg 561  Q
    |||||||||||||||||    
9390 acatttggtctcatagg 9406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188; HSP #7
Raw Score: 52; E-Value: 4e-20
Query Start/End: Original strand, 1151 - 1250
Target Start/End: Original strand, 11288 - 11387
Alignment:
1151 gaacgtgtgtcgaatattgcatataatgttgtgaatggtatttgcactcctataaaagatcaatcagctcctgtatacatacccattggagatggaggga 1250  Q
    |||||||| || ||||||||||||||| | || |||||||||||| ||||| ||||||||| ||||||||| |||||||||  ||| |||||||||||||    
11288 gaacgtgtctcaaatattgcatataatatcgtaaatggtatttgcgctcctgtaaaagatctatcagctccggtatacataaacatcggagatggaggga 11387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188; HSP #8
Raw Score: 44; E-Value: 0.000000000000003
Query Start/End: Original strand, 91 - 242
Target Start/End: Original strand, 8213 - 8364
Alignment:
91 ttattaccactagctttagttttgaatttagtgtcggtgtgtaatggaggcacaaccagtgcttttgttaggaatgttcagaaaggcgttaatatgtcac 190  Q
    |||||| |||||| ||| ||||||||||| ||||  |||||||||||| |  | || |||  |||||||||||| ||| ||||  || || ||||| |||    
8213 ttattatcactaggtttggttttgaatttggtgtttgtgtgtaatggaagttccacaagtatttttgttaggaaggttgagaagagcattgatatgccac 8312  T
191 ttgatagtgatgtttttgctgttccttctggttataatgctccccaacaggt 242  Q
    ||||||| |||||||||   |||||  |||||||||||||||| ||||||||    
8313 ttgatagcgatgtttttagggttccacctggttataatgctcctcaacaggt 8364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-16
Query Start/End: Original strand, 833 - 930
Target Start/End: Complemental strand, 10478895 - 10478798
Alignment:
833 actccttataaagcatcacaaagtacttcacccttttggtattctatcagaagagcttcagctcacatcattgtcttggcctcgtattcagcatatgg 930  Q
    ||||||||||||||||| |||||||   ||| |||||  ||||||||||  ||||||||||| ||||| |||||||| ||||| ||||||||||||||    
10478895 actccttataaagcatcgcaaagtagcccacacttttcatattctatcaagagagcttcagcacacattattgtcttagcctcatattcagcatatgg 10478798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000004
Query Start/End: Original strand, 1458 - 1550
Target Start/End: Complemental strand, 33632699 - 33632608
Alignment:
1458 ctcatgttttccattgatacattgatttactgctcttttcacaagaatactcaatgtgatgttaatcaataaagncatgattatgtaataatt 1550  Q
    ||||||||| ||||| | ||||||||||||| ||||||||  ||  | ||||||||||||||||||||||||||  ||||||||| |||||||    
33632699 ctcatgtttcccattaacacattgatttactactcttttccaaaacaaactcaatgtgatgttaatcaataaagt-atgattatgcaataatt 33632608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111117 times since January 2019
Visitors: 1335